Command Line Reference

Note

All subcommands, arguments, and options listed in these documents can be printed, along with a short explanation of each, on the command line by running seismic [command(s)] --help. For example, seismic --help prints all options and subcommands for the command seismic, seismic graph --help prints all options and subcommands for the command seismic graph, and seismic graph profile --help prints all options and subcommands for the command seismic graph profile.

Run the entire workflow

seismic wf

Run the entire workflow.

Usage

seismic wf [OPTIONS] FASTA [INPUT_PATH]...

Options

--wf-branch <wf_branch>

Run a step under a new branch: give the step name then the branch name (used multiple times to branch several steps)

--demult, --no-demult

Enable demultiplexing

-x, --fastqx <fastqx>

FASTQ files of paired-end reads with mates 1 and 2 in separate files

-y, --fastqy <fastqy>

FASTQ file(s) of paired-end reads with mates 1 and 2 interleaved

-z, --fastqz <fastqz>

FASTQ file(s) of single-end reads

-X, --dmfastqx <dmfastqx>

Demultiplexed FASTQ files of mate 1 and mate 2 reads

-Y, --dmfastqy <dmfastqy>

Demultiplexed FASTQ files of paired-end reads interleaved in one file

-Z, --dmfastqz <dmfastqz>

Demultiplexed FASTQ files of single-end reads

--phred-enc <phred_enc>

Specify the Phred score encoding of FASTQ and SAM/BAM/CRAM files

-R, --refs-meta <refs_meta>

Add reference metadata from this CSV file to exported results

--barcode-start <barcode_start>

Index of start of barcode

--barcode-end <barcode_end>

Index of end of barcode

--read-pos <read_pos>

Expected position of the barcode in the read (1-indexed). Defaults to –barcode-start

--barcode <barcode>

A list of barcode name, barcode sequence, and barcode position (1-indexed relative to read start) to demultiplex

--mismatch-tolerance <mismatch_tolerance>

Match patterns with up to this many mismatches (grows factorially; caution above 2; not applied to clipped sequences)

--index-tolerance <index_tolerance>

Allow patterns to be found in reads up to this distance from the reference index.

--allow-n, --no-allow-n

Allow N as a valid mismatch when –mismatch-tolerance ≥ 1. Increases memory consumption.

-o, --out-dir <out_dir>

Write all output files to this directory

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--keep-tmp, --erase-tmp

Keep temporary files after finishing

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

--fastp, --no-fastp

Use fastp to QC, filter, and trim reads before alignment

--fastp-5, --no-fastp-5

Trim low-quality bases from the 5’ ends of reads

--fastp-3, --no-fastp-3

Trim low-quality bases from the 3’ ends of reads

--fastp-w <fastp_w>

Use this window size (nt) for –fastp-5 and –fastp-3

--fastp-m <fastp_m>

Use this mean quality threshold for –fastp-5 and –fastp-3

--fastp-poly-g <fastp_poly_g>

Trim poly(G) tails (two-color sequencing artifacts) from the 3’ end

Options:

yes | no | auto

--fastp-poly-g-min-len <fastp_poly_g_min_len>

Minimum number of Gs to consider a poly(G) tail for –fastp-poly-g

--fastp-poly-x, --no-fastp-poly-x

Trim poly(X) tails (i.e. of any nucleotide) from the 3’ end

--fastp-poly-x-min-len <fastp_poly_x_min_len>

Minimum number of bases to consider a poly(X) tail for –fastp-poly-x

--fastp-adapter-trimming, --no-fastp-adapter-trimming

Trim adapter sequences from the 3’ ends of reads

--fastp-adapter-1 <fastp_adapter_1>

Trim this adapter sequence from the 3’ ends of read 1s

--fastp-adapter-2 <fastp_adapter_2>

Trim this adapter sequence from the 3’ ends of read 2s

--fastp-adapter-fasta <fastp_adapter_fasta>

Trim adapter sequences in this FASTA file from the 3’ ends of reads

--fastp-detect-adapter-for-pe, --no-fastp-detect-adapter-for-pe

Automatically detect the adapter sequences for paired-end reads

--fastp-min-length <fastp_min_length>

Discard reads shorter than this length

--bt2-local, --bt2-end-to-end

Align reads in local mode rather than end-to-end mode

--bt2-discordant, --bt2-no-discordant

Output paired-end reads whose mates align discordantly

--bt2-mixed, --bt2-no-mixed

Attempt to align individual mates of pairs that fail to align

--bt2-dovetail, --bt2-no-dovetail

Consider dovetailed mate pairs to align concordantly

--bt2-contain, --bt2-no-contain

Consider nested mate pairs to align concordantly

--bt2-I <bt2_i>

Discard paired-end alignments shorter than this many bases

--bt2-X <bt2_x>

Discard paired-end alignments longer than this many bases

--bt2-score-min-e2e <bt2_score_min_e2e>

Discard alignments that score below this threshold in end-to-end mode

--bt2-score-min-loc <bt2_score_min_loc>

Discard alignments that score below this threshold in local mode

--bt2-i <bt2_s>

Seed Bowtie2 alignments at this interval

--bt2-L <bt2_l>

Use this seed length for Bowtie2

--bt2-gbar <bt2_gbar>

Do not place gaps within this many bases from the end of a read

--bt2-D <bt2_d>

Discard alignments if over this many consecutive seed extensions fail

--bt2-R <bt2_r>

Re-seed reads with repetitive seeds up to this many times

--bt2-dpad <bt2_dpad>

Pad the alignment matrix with this many bases (to allow gaps)

--bt2-orient <bt2_orient>

Require paired mates to have this orientation

Options:

fr | rf | ff

--bt2-un, --bt2-no-un

Output unaligned reads to a FASTQ file

--seed <seed>

Seed for the random number generator

--min-mapq <min_mapq>

Discard reads with mapping qualities below this threshold

-N, --min-reads <min_reads>

Discard alignment maps with fewer than this many reads

--sep-strands, --mix-strands

Separate each alignment map into forward- and reverse-strand reads

--f1r2-fwd, --f1r2-rev

With –sep-strands, consider forward mate 1s and reverse mate 2s to be forward-stranded

--rev-label <rev_label>

With –sep-strands, add this label to each reverse-strand reference

--min-phred <min_phred>

Mark base calls with Phred scores lower than this threshold as ambiguous

--batch-size <batch_size>

Limit batches to at most this many reads

--insert3, --insert5

Mark each insertion on the base to its 3’ (True) or 5’ (False) side

--ambindel, --no-ambindel

Mark all ambiguous insertions and deletions (indels)

--overhangs, --no-overhangs

Retain the overhangs of paired-end mates that dovetail

-5, --clip-end5 <clip_end5>

Clip this many bases from the 5’ end of each read

-3, --clip-end3 <clip_end3>

Clip this many bases from the 3’ end of each read

--brotli-level <brotli_level>

Compress pickle files with this level of Brotli (0 - 11)

--write-read-names, --no-write-read-names

Write the name of each read in a second set of batches (necessary for the options –drop-read or –drop-read-file)

--idmut-pos-table, --no-idmut-pos-table

Tabulate relationships per position for idmut data

--idmut-read-table, --no-idmut-read-table

Tabulate relationships per read for idmut data

--idmut-cx, --idmut-py

Use the fast C-extension idmut algorithm; the slow Python version is a fallback if the C extension fails to load

-c, --region-coords <region_coords>

Select a region of a reference given its 5’ and 3’ end coordinates

-P, --region-primers <region_primers>

Select a region of a reference given its forward and reverse primers

--primer-gap <primer_gap>

Leave a gap of this many bases between the primer and the region

-i, --regions-file <regions_file>

Select regions of references from coordinates/primers in a CSV file

--count-del, --no-del

Count deletions as mutations

--count-ins, --no-ins

Count insertions as mutations

--no-mut <no_mut>

Do not count this type of mutation (overrides –count-del/ins)

--only-mut <only_mut>

Count only this type of mutation (overrides other mutation settings)

--probe <probe>

Use the default options for this chemical probe

Options:

DMS | SHAPE | ETC | none

--mask-a, --keep-a

Mask positions with base A

--mask-c, --keep-c

Mask positions with base C

--mask-g, --keep-g

Mask positions with base G

--mask-u, --keep-u

Mask positions with base U

--mask-polya <mask_polya>

Mask stretches of at least this many consecutive A bases (0 disables); defaults to 5 for chemical probes, 0 for none

--mask-pos <mask_pos>

Mask this position in this reference

--mask-pos-file <mask_pos_file>

Mask positions in references from a file

--min-ninfo-pos <min_ninfo_pos>

Mask positions with fewer than this many informative base calls

--max-fmut-pos <max_fmut_pos>

Mask positions with more than this fraction of mutated base calls

--drop-read <drop_read>

Drop the read with this name

--drop-read-file <drop_read_file>

Drop the reads with names in this file

--drop-discontig, --keep-discontig

Drop paired-end reads with discontiguous mates

--min-ncov-read <min_ncov_read>

Drop reads with fewer than this many bases covering the region

--min-fcov-read <min_fcov_read>

Drop reads covering less than this fraction of the region

--min-finfo-read <min_finfo_read>

Drop reads with less than this fraction of informative base calls

--max-fmut-read <max_fmut_read>

Drop reads with more than this fraction of mutated base calls

--min-mut-gap <min_mut_gap>

Filter out mutations separated by fewer than this many bases

--mut-collisions <mut_collisions>

If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.

Options:

drop | merge | auto

--quick-unbias, --exact-unbias

Correct observer bias using a quick (typically linear time) heuristic

--quick-unbias-thresh <quick_unbias_thresh>

Treat mutated fractions under this threshold as 0 with –quick-unbias

--max-filter-iter <max_filter_iter>

Stop the filter step after this many iterations (0 for no limit)

--filter-pos-table, --no-filter-pos-table

Tabulate relationships per position for filter data

--filter-read-table, --no-filter-read-table

Tabulate relationships per read for filter data

--self-contained, --no-self-contained

Write self-contained batch files that skip loading predecessor batches (Filter/Cluster steps); costs more disk space

--scan, --no-scan

Scan the RNA for domains (filterscan) and cluster them (clusterscan)

-L, --tile-length <tile_length>

Make each tile this length (if 0, use 2x the median read length)

-O, --tile-min-overlap <tile_min_overlap>

Make adjacent tiles overlap by at least this fraction of length

--erase-tiles, --keep-tiles

Erase the filter reports/batches from the tiling step

--band-width <band_width>

Consider only position pairs no more than this far apart when finding domains (0 = bounded only by tile length)

--min-pair-coverage <min_pair_coverage>

Analyze only position pairs with at least this many jointly covering reads (fewer reads are too noisy to score reliably)

--min-expect-both <min_expect_both>

Analyze only position pairs whose expected both-mutated read count (under independence) is at least this value

--pair-fdr <pair_fdr>

FDR (Benjamini-Hochberg) for calling a pair a domain-boundary bridge; higher calls more bridges

--min-fold-change <min_fold_change>

Minimum expected-to-observed both-mutated fold change to call a pair a bridge; higher requires a larger effect

--detect-fdr <detect_fdr>

FDR (Benjamini-Hochberg) for calling a region a domain by bridge-pair enrichment; higher calls more (weaker) domains

--merge-fdr <merge_fdr>

FDR (Benjamini-Hochberg) for merging adjacent domains by bridge-pair enrichment; higher merges more, lower merges fewer

--widen, --no-widen

Grow each domain into its flanking gaps up to max-domain-length (runs before –fill); closes small gaps entirely

--fill, --no-fill

Insert domains into every remaining gap (after –widen) so each position is in exactly one domain

--max-domain-length <max_domain_length>

Bound every candidate domain to at most this many positions (0 = 2x median read length)

--min-domain-length <min_domain_length>

Keep only domains with at least this many positions (skipped with –widen, which grows short domains instead)

--min-pairs <min_pairs>

Keep only domains containing at least this many bridge pairs

--min-clusters <min_clusters>

Start at this many clusters

-k, --max-clusters <max_clusters>

Stop at this many clusters (0 for no limit)

-e, --min-em-runs <min_em_runs>

Run EM (successfully) at least this number of times for each K

-E, --max-em-runs <max_em_runs>

Run EM (successfully or not) at most this number of times for each K

--em-thresh <em_thresh>

Stop EM when the log likelihood increases by less than this threshold

--min-em-iter <min_em_iter>

Run EM for at least this many iterations

--max-em-iter <max_em_iter>

Run EM for at most this many iterations

--max-pearson-run <max_pearson_run>

Remove runs with two clusters more similar than this correlation

--min-marcd-run <min_marcd_run>

Remove runs with two clusters that differ by less than this MARCD

--max-arcd-vs-ens-avg <max_arcd_vs_ens_avg>

Remove runs where a cluster differs by more than this ARCD from the ensemble average at any position

--max-gini-run <max_gini_run>

Remove runs where any cluster’s Gini coefficient exceeds this limit

--jackpot, --no-jackpot

Calculate the jackpotting quotient to find over-represented reads

--jackpot-conf-level <jackpot_conf_level>

Confidence level for the jackpotting quotient confidence interval

--max-jackpot-quotient <max_jackpot_quotient>

Remove runs whose jackpotting quotient exceeds this limit

--max-jackpot-sims <max_jackpot_sims>

Maximum number of simulations to compute the jackpotting quotient

--jackpot-max-data <jackpot_max_data>

Skip calculating the jackpotting quotient if the reads × positions exceeds this limit

--max-loglike-vs-best <max_loglike_vs_best>

Remove Ks with a log likelihood gap larger than this (0 for no limit)

--min-pearson-vs-best <min_pearson_vs_best>

Remove Ks where every run has less than this correlation vs. the best

--max-marcd-vs-best <max_marcd_vs_best>

Remove Ks where every run has more than this MARCD vs. the best

--try-all-ks, --stop-best-k

Try all numbers of clusters (Ks), even after finding the best number

--write-all-ks, --write-best-k

Write all numbers of clusters (Ks), rather than only the best number

--cluster-pos-table, --no-cluster-pos-table

Tabulate relationships per position for cluster data

--cluster-abundance-table, --no-cluster-abundance-table

Tabulate number of reads per cluster for cluster data

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--validate-gaps, --no-validate-gaps

In clusterscan, test each gap between domains for independence and merge failing gaps; off by default (expensive)

--gap-min-assoc <gap_min_assoc>

Minimum deviation of fitted joint cluster proportions from independence to keep a gap unmerged; higher merges fewer gaps

--cluster, --no-cluster

Cluster reads to find alternative structures

--fold, --no-fold

Predict the secondary structure using the reactivities

-F, --fold-regions-file <fold_regions_file>

Fold regions of references from coordinates/primers in a CSV file

--fold-coords <fold_coords>

Fold a region of a reference given its 5’ and 3’ end coordinates

--fold-primers <fold_primers>

Fold a region of a reference given its forward and reverse primers

--fold-table-region, --fold-full-region

If no regions are specified, whether to default to the table’s region or to the full region

--fold-dry-run, --fold-real-run

Only generate the fold command and input files; do not run folding

--fold-backend <fold_backend>

Model RNA structures using RNAstructure (Fold/ShapeKnots) or ViennaRNA (RNAfold/RNAsubopt); auto selects RNAstructure for DMS and ViennaRNA for other probes

Options:

auto | RNAstructure | ViennaRNA

--pseudoknots, --no-pseudoknots

Predict pseudoknotted structures (requires –fold-backend=RNAstructure; uses ShapeKnots when set, Fold otherwise)

--fold-energy-method <fold_energy_method>

Use this method to incorporate reactivities into folding energies. auto selects Cordero for DMS and Eddy for other probes; Eddy requires –fold-backend=ViennaRNA; Cordero requires –fold-backend=RNAstructure

Options:

auto | Deigan | Cordero | Eddy

--fold-temp <fold_temp>

Predict structures at this temperature (Celsius)

--deigan-slope <deigan_slope>

Slope (kcal/mol) for SHAPE reactivities using Deigan method; used only with –fold-energy-method=Deigan

--deigan-intercept <deigan_intercept>

Intercept (kcal/mol) for SHAPE reactivities using Deigan method; used only with –fold-energy-method=Deigan

--fold-quantile <fold_quantile>

Normalize and winsorize reactivities to this quantile for folding

--fold-fpaired <fold_fpaired>

Assume this fraction of bases is paired when computing Cordero pseudoenergies for cofolding

--fold-constraint <fold_constraint>

Force bases to be paired/unpaired from a file of constraints

--fold-commands <fold_commands>

Command file for RNAFold

--eddy-prior-paired-file <eddy_prior_paired_file>

File of per-position prior probabilities of being paired for the Eddy method (passed as –sp-data with –sp-strategy Pp); only used with –fold-energy-method=Eddy and –fold-backend=ViennaRNA

--eddy-prior-unpaired-file <eddy_prior_unpaired_file>

File of per-position prior probabilities of being unpaired for the Eddy method (passed as –sp-data with –sp-strategy Pu); only used with –fold-energy-method=Eddy and –fold-backend=ViennaRNA

--fold-md <fold_md>

Limit base pair distances to this number of bases (0 for no limit)

--fold-mfe, --fold-sub

Predict only the minimum free energy (MFE) structure

--fold-max <fold_max>

Output at most this many structures (overriden by –fold-mfe)

--fold-percent <fold_percent>

Stop outputting structures when the % difference in energy exceeds this value (overriden by –fold-mfe)

--fold-edelta <fold_edelta>

Maximum energy difference (kcal/mol) from the MFE for suboptimal structures from RNAsubopt (overriden by –fold-mfe)

--fold-isolated, --fold-stacked

Allow isolated (non-stacked) base pairs when folding

--draw, --no-draw

Draw secondary structures with RNArtist.

--struct-num <struct_num>

Draw the specified structure (zero-indexed) or -1 for all; by default, draws the structure with the best AUROC.

--color, --no-color

Color bases by their reactivity

--draw-svg, --no-draw-svg

Output each drawing in a Scalable Vector Graphics file

--draw-png, --no-draw-png

Output each drawing in a Portable Network Graphics file

--update-rnartistcore, --no-update-rnartistcore

Check for and install updates to RNArtistCore.

--export, --no-export

Export each sample to SEISMICgraph (https://seismicrna.org)

-S, --samples-meta <samples_meta>

Add sample metadata from this CSV file to exported results

--all-pos, --unmasked-pos

Export all positions (not just unmasked positions)

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

--hist-bins <hist_bins>

Number of bins in each histogram; must be ≥ 1

--hist-margin <hist_margin>

Autofill margins of at most this width in histograms of ratios

--struct-file <struct_file>

Compare mutational profiles to the structure(s) in this CT file

--terminal-pairs, --no-terminal-pairs

Include terminal base pairs (at the ends of stems) in ROC curves

--window <window>

Use a sliding window of this many bases

-n, --winmin <winmin>

Mask sliding windows with fewer than this number of data

--graph-quantile <graph_quantile>

Normalize and winsorize ratios to this quantile (0 disables)

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--graph-mprof, --no-graph-mprof

Graph mutational profiles

--graph-tmprof, --no-graph-tmprof

Graph typed mutational profiles

--graph-ncov, --no-graph-ncov

Graph coverages per position

--graph-mhist, --no-graph-mhist

Graph histograms of mutations per read

--graph-abundance, --no-graph-abundance

Graph abundance of each cluster

--graph-giniroll, --no-graph-giniroll

Graph rolling Gini coefficients

--graph-roc, --no-graph-roc

Graph receiver operating characteristic (ROC) curves

--graph-aucroll, --no-graph-aucroll

Graph rolling areas under ROC curves (AUC-ROC)

--graph-poscorr, --no-graph-poscorr

Graph phi correlations between positions

--graph-mutdist, --no-graph-mutdist

Graph distances between mutations

--mutdist-null, --no-mutdist-null

Include the null distribution of distances between mutations

--collate, --no-collate

Collate HTML graphs and SVG drawings into an HTML report file.

--name <name>

Prefix the HTML report with this name.

--verbose-name, --no-verbose-name

Add collated file information to report name.

--collate-out-dir <collate_out_dir>

Write collated report to this directory. By default, write to the lowest level directory common to all input graphs.

--include-svg, --no-include-svg

Include RNA structure drawings from the draw module.

--include-graph, --no-include-graph

Include graphs from the graph module.

--group <group>

Group collated graphs by one of ‘sample’, ‘graph’, ‘branches’, ‘region’, or ‘all’.

--portable, --no-portable

Embed collated graphs into the output HTML file for portability at the expense of live updates and file size.

Arguments

FASTA

Required argument

INPUT_PATH

Optional argument(s)

Run individual steps of the workflow

seismic demult

Demultiplex sequencing reads by their barcode.

Usage

seismic demult [OPTIONS] FASTA

Options

-x, --fastqx <fastqx>

FASTQ files of paired-end reads with mates 1 and 2 in separate files

-y, --fastqy <fastqy>

FASTQ file(s) of paired-end reads with mates 1 and 2 interleaved

-z, --fastqz <fastqz>

FASTQ file(s) of single-end reads

-X, --dmfastqx <dmfastqx>

Demultiplexed FASTQ files of mate 1 and mate 2 reads

-Y, --dmfastqy <dmfastqy>

Demultiplexed FASTQ files of paired-end reads interleaved in one file

-Z, --dmfastqz <dmfastqz>

Demultiplexed FASTQ files of single-end reads

--phred-enc <phred_enc>

Specify the Phred score encoding of FASTQ and SAM/BAM/CRAM files

-R, --refs-meta <refs_meta>

Add reference metadata from this CSV file to exported results

--barcode-start <barcode_start>

Index of start of barcode

--barcode-end <barcode_end>

Index of end of barcode

--read-pos <read_pos>

Expected position of the barcode in the read (1-indexed). Defaults to –barcode-start

--barcode <barcode>

A list of barcode name, barcode sequence, and barcode position (1-indexed relative to read start) to demultiplex

--mismatch-tolerance <mismatch_tolerance>

Match patterns with up to this many mismatches (grows factorially; caution above 2; not applied to clipped sequences)

--index-tolerance <index_tolerance>

Allow patterns to be found in reads up to this distance from the reference index.

--allow-n, --no-allow-n

Allow N as a valid mismatch when –mismatch-tolerance ≥ 1. Increases memory consumption.

-o, --out-dir <out_dir>

Write all output files to this directory

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--keep-tmp, --erase-tmp

Keep temporary files after finishing

-b, --branch <branch>

Create a new branch of the workflow with this name

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

Arguments

FASTA

Required argument

seismic align

Trim FASTQ files and align them to reference sequences.

Usage

seismic align [OPTIONS] FASTA

Options

-x, --fastqx <fastqx>

FASTQ files of paired-end reads with mates 1 and 2 in separate files

-y, --fastqy <fastqy>

FASTQ file(s) of paired-end reads with mates 1 and 2 interleaved

-z, --fastqz <fastqz>

FASTQ file(s) of single-end reads

-X, --dmfastqx <dmfastqx>

Demultiplexed FASTQ files of mate 1 and mate 2 reads

-Y, --dmfastqy <dmfastqy>

Demultiplexed FASTQ files of paired-end reads interleaved in one file

-Z, --dmfastqz <dmfastqz>

Demultiplexed FASTQ files of single-end reads

--phred-enc <phred_enc>

Specify the Phred score encoding of FASTQ and SAM/BAM/CRAM files

-o, --out-dir <out_dir>

Write all output files to this directory

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--keep-tmp, --erase-tmp

Keep temporary files after finishing

-b, --branch <branch>

Create a new branch of the workflow with this name

--fastp, --no-fastp

Use fastp to QC, filter, and trim reads before alignment

--fastp-5, --no-fastp-5

Trim low-quality bases from the 5’ ends of reads

--fastp-3, --no-fastp-3

Trim low-quality bases from the 3’ ends of reads

--fastp-w <fastp_w>

Use this window size (nt) for –fastp-5 and –fastp-3

--fastp-m <fastp_m>

Use this mean quality threshold for –fastp-5 and –fastp-3

--fastp-poly-g <fastp_poly_g>

Trim poly(G) tails (two-color sequencing artifacts) from the 3’ end

Options:

yes | no | auto

--fastp-poly-g-min-len <fastp_poly_g_min_len>

Minimum number of Gs to consider a poly(G) tail for –fastp-poly-g

--fastp-poly-x, --no-fastp-poly-x

Trim poly(X) tails (i.e. of any nucleotide) from the 3’ end

--fastp-poly-x-min-len <fastp_poly_x_min_len>

Minimum number of bases to consider a poly(X) tail for –fastp-poly-x

--fastp-adapter-trimming, --no-fastp-adapter-trimming

Trim adapter sequences from the 3’ ends of reads

--fastp-adapter-1 <fastp_adapter_1>

Trim this adapter sequence from the 3’ ends of read 1s

--fastp-adapter-2 <fastp_adapter_2>

Trim this adapter sequence from the 3’ ends of read 2s

--fastp-adapter-fasta <fastp_adapter_fasta>

Trim adapter sequences in this FASTA file from the 3’ ends of reads

--fastp-detect-adapter-for-pe, --no-fastp-detect-adapter-for-pe

Automatically detect the adapter sequences for paired-end reads

--fastp-min-length <fastp_min_length>

Discard reads shorter than this length

--bt2-local, --bt2-end-to-end

Align reads in local mode rather than end-to-end mode

--bt2-discordant, --bt2-no-discordant

Output paired-end reads whose mates align discordantly

--bt2-mixed, --bt2-no-mixed

Attempt to align individual mates of pairs that fail to align

--bt2-dovetail, --bt2-no-dovetail

Consider dovetailed mate pairs to align concordantly

--bt2-contain, --bt2-no-contain

Consider nested mate pairs to align concordantly

--bt2-I <bt2_i>

Discard paired-end alignments shorter than this many bases

--bt2-X <bt2_x>

Discard paired-end alignments longer than this many bases

--bt2-score-min-e2e <bt2_score_min_e2e>

Discard alignments that score below this threshold in end-to-end mode

--bt2-score-min-loc <bt2_score_min_loc>

Discard alignments that score below this threshold in local mode

--bt2-i <bt2_s>

Seed Bowtie2 alignments at this interval

--bt2-L <bt2_l>

Use this seed length for Bowtie2

--bt2-gbar <bt2_gbar>

Do not place gaps within this many bases from the end of a read

--bt2-D <bt2_d>

Discard alignments if over this many consecutive seed extensions fail

--bt2-R <bt2_r>

Re-seed reads with repetitive seeds up to this many times

--bt2-dpad <bt2_dpad>

Pad the alignment matrix with this many bases (to allow gaps)

--bt2-orient <bt2_orient>

Require paired mates to have this orientation

Options:

fr | rf | ff

--bt2-un, --bt2-no-un

Output unaligned reads to a FASTQ file

--seed <seed>

Seed for the random number generator

--min-mapq <min_mapq>

Discard reads with mapping qualities below this threshold

-N, --min-reads <min_reads>

Discard alignment maps with fewer than this many reads

--sep-strands, --mix-strands

Separate each alignment map into forward- and reverse-strand reads

--f1r2-fwd, --f1r2-rev

With –sep-strands, consider forward mate 1s and reverse mate 2s to be forward-stranded

--rev-label <rev_label>

With –sep-strands, add this label to each reverse-strand reference

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

Arguments

FASTA

Required argument

seismic idmut

Identify mutations in aligned reads.

Usage

seismic idmut [OPTIONS] FASTA [INPUT_PATH]...

Options

--sep-strands, --mix-strands

Separate each alignment map into forward- and reverse-strand reads

--rev-label <rev_label>

With –sep-strands, add this label to each reverse-strand reference

-o, --out-dir <out_dir>

Write all output files to this directory

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

-b, --branch <branch>

Create a new branch of the workflow with this name

--min-mapq <min_mapq>

Discard reads with mapping qualities below this threshold

--phred-enc <phred_enc>

Specify the Phred score encoding of FASTQ and SAM/BAM/CRAM files

--min-phred <min_phred>

Mark base calls with Phred scores lower than this threshold as ambiguous

-N, --min-reads <min_reads>

Discard alignment maps with fewer than this many reads

--batch-size <batch_size>

Limit batches to at most this many reads

--insert3, --insert5

Mark each insertion on the base to its 3’ (True) or 5’ (False) side

--ambindel, --no-ambindel

Mark all ambiguous insertions and deletions (indels)

--overhangs, --no-overhangs

Retain the overhangs of paired-end mates that dovetail

-5, --clip-end5 <clip_end5>

Clip this many bases from the 5’ end of each read

-3, --clip-end3 <clip_end3>

Clip this many bases from the 3’ end of each read

--brotli-level <brotli_level>

Compress pickle files with this level of Brotli (0 - 11)

--write-read-names, --no-write-read-names

Write the name of each read in a second set of batches (necessary for the options –drop-read or –drop-read-file)

--idmut-pos-table, --no-idmut-pos-table

Tabulate relationships per position for idmut data

--idmut-read-table, --no-idmut-read-table

Tabulate relationships per read for idmut data

--idmut-cx, --idmut-py

Use the fast C-extension idmut algorithm; the slow Python version is a fallback if the C extension fails to load

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

--keep-tmp, --erase-tmp

Keep temporary files after finishing

Arguments

FASTA

Required argument

INPUT_PATH

Optional argument(s)

seismic pool

Merge samples (vertically) from the IDmut step.

Usage

seismic pool [OPTIONS] POOLED_SAMPLE [INPUT_PATH]...

Options

--idmut-pos-table, --no-idmut-pos-table

Tabulate relationships per position for idmut data

--idmut-read-table, --no-idmut-read-table

Tabulate relationships per read for idmut data

--min-pearson <min_pearson>

Pool samples only if their Pearson correlation is at least this large

--max-marcd <max_marcd>

Pool samples only if their mean arsince distance is at most this

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--keep-tmp, --erase-tmp

Keep temporary files after finishing

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

Arguments

POOLED_SAMPLE

Required argument

INPUT_PATH

Optional argument(s)

seismic filter

Define mutations and regions to filter reads and positions.

Usage

seismic filter [OPTIONS] [INPUT_PATH]...

Options

-b, --branch <branch>

Create a new branch of the workflow with this name

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--keep-tmp, --erase-tmp

Keep temporary files after finishing

-c, --region-coords <region_coords>

Select a region of a reference given its 5’ and 3’ end coordinates

-P, --region-primers <region_primers>

Select a region of a reference given its forward and reverse primers

--primer-gap <primer_gap>

Leave a gap of this many bases between the primer and the region

-i, --regions-file <regions_file>

Select regions of references from coordinates/primers in a CSV file

--count-del, --no-del

Count deletions as mutations

--count-ins, --no-ins

Count insertions as mutations

--no-mut <no_mut>

Do not count this type of mutation (overrides –count-del/ins)

--only-mut <only_mut>

Count only this type of mutation (overrides other mutation settings)

--probe <probe>

Use the default options for this chemical probe

Options:

DMS | SHAPE | ETC | none

--mask-a, --keep-a

Mask positions with base A

--mask-c, --keep-c

Mask positions with base C

--mask-g, --keep-g

Mask positions with base G

--mask-u, --keep-u

Mask positions with base U

--mask-polya <mask_polya>

Mask stretches of at least this many consecutive A bases (0 disables); defaults to 5 for chemical probes, 0 for none

--mask-pos <mask_pos>

Mask this position in this reference

--mask-pos-file <mask_pos_file>

Mask positions in references from a file

--min-ninfo-pos <min_ninfo_pos>

Mask positions with fewer than this many informative base calls

--max-fmut-pos <max_fmut_pos>

Mask positions with more than this fraction of mutated base calls

--drop-read <drop_read>

Drop the read with this name

--drop-read-file <drop_read_file>

Drop the reads with names in this file

--drop-discontig, --keep-discontig

Drop paired-end reads with discontiguous mates

--min-ncov-read <min_ncov_read>

Drop reads with fewer than this many bases covering the region

--min-fcov-read <min_fcov_read>

Drop reads covering less than this fraction of the region

--min-finfo-read <min_finfo_read>

Drop reads with less than this fraction of informative base calls

--max-fmut-read <max_fmut_read>

Drop reads with more than this fraction of mutated base calls

--min-mut-gap <min_mut_gap>

Filter out mutations separated by fewer than this many bases

--mut-collisions <mut_collisions>

If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.

Options:

drop | merge | auto

--quick-unbias, --exact-unbias

Correct observer bias using a quick (typically linear time) heuristic

--quick-unbias-thresh <quick_unbias_thresh>

Treat mutated fractions under this threshold as 0 with –quick-unbias

--max-filter-iter <max_filter_iter>

Stop the filter step after this many iterations (0 for no limit)

--filter-pos-table, --no-filter-pos-table

Tabulate relationships per position for filter data

--filter-read-table, --no-filter-read-table

Tabulate relationships per read for filter data

--brotli-level <brotli_level>

Compress pickle files with this level of Brotli (0 - 11)

--self-contained, --no-self-contained

Write self-contained batch files that skip loading predecessor batches (Filter/Cluster steps); costs more disk space

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

Arguments

INPUT_PATH

Optional argument(s)

seismic cluster

Infer structure ensembles by clustering reads’ mutations.

Usage

seismic cluster [OPTIONS] [INPUT_PATH]...

Options

-b, --branch <branch>

Create a new branch of the workflow with this name

--min-clusters <min_clusters>

Start at this many clusters

-k, --max-clusters <max_clusters>

Stop at this many clusters (0 for no limit)

-e, --min-em-runs <min_em_runs>

Run EM (successfully) at least this number of times for each K

-E, --max-em-runs <max_em_runs>

Run EM (successfully or not) at most this number of times for each K

--em-thresh <em_thresh>

Stop EM when the log likelihood increases by less than this threshold

--min-em-iter <min_em_iter>

Run EM for at least this many iterations

--max-em-iter <max_em_iter>

Run EM for at most this many iterations

--max-pearson-run <max_pearson_run>

Remove runs with two clusters more similar than this correlation

--min-marcd-run <min_marcd_run>

Remove runs with two clusters that differ by less than this MARCD

--max-arcd-vs-ens-avg <max_arcd_vs_ens_avg>

Remove runs where a cluster differs by more than this ARCD from the ensemble average at any position

--max-gini-run <max_gini_run>

Remove runs where any cluster’s Gini coefficient exceeds this limit

--jackpot, --no-jackpot

Calculate the jackpotting quotient to find over-represented reads

--jackpot-conf-level <jackpot_conf_level>

Confidence level for the jackpotting quotient confidence interval

--max-jackpot-quotient <max_jackpot_quotient>

Remove runs whose jackpotting quotient exceeds this limit

--max-jackpot-sims <max_jackpot_sims>

Maximum number of simulations to compute the jackpotting quotient

--jackpot-max-data <jackpot_max_data>

Skip calculating the jackpotting quotient if the reads × positions exceeds this limit

--max-loglike-vs-best <max_loglike_vs_best>

Remove Ks with a log likelihood gap larger than this (0 for no limit)

--min-pearson-vs-best <min_pearson_vs_best>

Remove Ks where every run has less than this correlation vs. the best

--max-marcd-vs-best <max_marcd_vs_best>

Remove Ks where every run has more than this MARCD vs. the best

--try-all-ks, --stop-best-k

Try all numbers of clusters (Ks), even after finding the best number

--write-all-ks, --write-best-k

Write all numbers of clusters (Ks), rather than only the best number

--cluster-pos-table, --no-cluster-pos-table

Tabulate relationships per position for cluster data

--cluster-abundance-table, --no-cluster-abundance-table

Tabulate number of reads per cluster for cluster data

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--brotli-level <brotli_level>

Compress pickle files with this level of Brotli (0 - 11)

--self-contained, --no-self-contained

Write self-contained batch files that skip loading predecessor batches (Filter/Cluster steps); costs more disk space

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--keep-tmp, --erase-tmp

Keep temporary files after finishing

--seed <seed>

Seed for the random number generator

Arguments

INPUT_PATH

Optional argument(s)

seismic join

Merge regions (horizontally) from the Filter or Cluster step.

Usage

seismic join [OPTIONS] JOINED_REGION [INPUT_PATH]...

Options

-j, --join-clusts <join_clusts>

Specify which clusters to join clusters using this CSV file

--filter-pos-table, --no-filter-pos-table

Tabulate relationships per position for filter data

--filter-read-table, --no-filter-read-table

Tabulate relationships per read for filter data

--cluster-pos-table, --no-cluster-pos-table

Tabulate relationships per position for cluster data

--cluster-abundance-table, --no-cluster-abundance-table

Tabulate number of reads per cluster for cluster data

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--keep-tmp, --erase-tmp

Keep temporary files after finishing

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

Arguments

JOINED_REGION

Required argument

INPUT_PATH

Optional argument(s)

seismic filterscan

Scan an RNA for domains of correlated base pairs.

Usage

seismic filterscan [OPTIONS] [INPUT_PATH]...

Options

-b, --branch <branch>

Create a new branch of the workflow with this name

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--keep-tmp, --erase-tmp

Keep temporary files after finishing

-c, --region-coords <region_coords>

Select a region of a reference given its 5’ and 3’ end coordinates

-P, --region-primers <region_primers>

Select a region of a reference given its forward and reverse primers

--primer-gap <primer_gap>

Leave a gap of this many bases between the primer and the region

-i, --regions-file <regions_file>

Select regions of references from coordinates/primers in a CSV file

--count-del, --no-del

Count deletions as mutations

--count-ins, --no-ins

Count insertions as mutations

--no-mut <no_mut>

Do not count this type of mutation (overrides –count-del/ins)

--only-mut <only_mut>

Count only this type of mutation (overrides other mutation settings)

--probe <probe>

Use the default options for this chemical probe

Options:

DMS | SHAPE | ETC | none

--mask-a, --keep-a

Mask positions with base A

--mask-c, --keep-c

Mask positions with base C

--mask-g, --keep-g

Mask positions with base G

--mask-u, --keep-u

Mask positions with base U

--mask-polya <mask_polya>

Mask stretches of at least this many consecutive A bases (0 disables); defaults to 5 for chemical probes, 0 for none

--mask-pos <mask_pos>

Mask this position in this reference

--mask-pos-file <mask_pos_file>

Mask positions in references from a file

--min-ninfo-pos <min_ninfo_pos>

Mask positions with fewer than this many informative base calls

--max-fmut-pos <max_fmut_pos>

Mask positions with more than this fraction of mutated base calls

--drop-read <drop_read>

Drop the read with this name

--drop-read-file <drop_read_file>

Drop the reads with names in this file

--drop-discontig, --keep-discontig

Drop paired-end reads with discontiguous mates

--min-ncov-read <min_ncov_read>

Drop reads with fewer than this many bases covering the region

--min-fcov-read <min_fcov_read>

Drop reads covering less than this fraction of the region

--min-finfo-read <min_finfo_read>

Drop reads with less than this fraction of informative base calls

--max-fmut-read <max_fmut_read>

Drop reads with more than this fraction of mutated base calls

--min-mut-gap <min_mut_gap>

Filter out mutations separated by fewer than this many bases

--mut-collisions <mut_collisions>

If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.

Options:

drop | merge | auto

--quick-unbias, --exact-unbias

Correct observer bias using a quick (typically linear time) heuristic

--quick-unbias-thresh <quick_unbias_thresh>

Treat mutated fractions under this threshold as 0 with –quick-unbias

--max-filter-iter <max_filter_iter>

Stop the filter step after this many iterations (0 for no limit)

--filter-pos-table, --no-filter-pos-table

Tabulate relationships per position for filter data

--filter-read-table, --no-filter-read-table

Tabulate relationships per read for filter data

--brotli-level <brotli_level>

Compress pickle files with this level of Brotli (0 - 11)

--self-contained, --no-self-contained

Write self-contained batch files that skip loading predecessor batches (Filter/Cluster steps); costs more disk space

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

-L, --tile-length <tile_length>

Make each tile this length (if 0, use 2x the median read length)

-O, --tile-min-overlap <tile_min_overlap>

Make adjacent tiles overlap by at least this fraction of length

--erase-tiles, --keep-tiles

Erase the filter reports/batches from the tiling step

--band-width <band_width>

Consider only position pairs no more than this far apart when finding domains (0 = bounded only by tile length)

--min-pair-coverage <min_pair_coverage>

Analyze only position pairs with at least this many jointly covering reads (fewer reads are too noisy to score reliably)

--min-expect-both <min_expect_both>

Analyze only position pairs whose expected both-mutated read count (under independence) is at least this value

--pair-fdr <pair_fdr>

FDR (Benjamini-Hochberg) for calling a pair a domain-boundary bridge; higher calls more bridges

--min-fold-change <min_fold_change>

Minimum expected-to-observed both-mutated fold change to call a pair a bridge; higher requires a larger effect

--detect-fdr <detect_fdr>

FDR (Benjamini-Hochberg) for calling a region a domain by bridge-pair enrichment; higher calls more (weaker) domains

--merge-fdr <merge_fdr>

FDR (Benjamini-Hochberg) for merging adjacent domains by bridge-pair enrichment; higher merges more, lower merges fewer

--widen, --no-widen

Grow each domain into its flanking gaps up to max-domain-length (runs before –fill); closes small gaps entirely

--fill, --no-fill

Insert domains into every remaining gap (after –widen) so each position is in exactly one domain

--max-domain-length <max_domain_length>

Bound every candidate domain to at most this many positions (0 = 2x median read length)

--min-domain-length <min_domain_length>

Keep only domains with at least this many positions (skipped with –widen, which grows short domains instead)

--min-pairs <min_pairs>

Keep only domains containing at least this many bridge pairs

Arguments

INPUT_PATH

Optional argument(s)

seismic clusterscan

Cluster the domains detected by filterscan.

Usage

seismic clusterscan [OPTIONS] [INPUT_PATH]...

Options

-b, --branch <branch>

Create a new branch of the workflow with this name

--min-clusters <min_clusters>

Start at this many clusters

-k, --max-clusters <max_clusters>

Stop at this many clusters (0 for no limit)

-e, --min-em-runs <min_em_runs>

Run EM (successfully) at least this number of times for each K

-E, --max-em-runs <max_em_runs>

Run EM (successfully or not) at most this number of times for each K

--em-thresh <em_thresh>

Stop EM when the log likelihood increases by less than this threshold

--min-em-iter <min_em_iter>

Run EM for at least this many iterations

--max-em-iter <max_em_iter>

Run EM for at most this many iterations

--max-pearson-run <max_pearson_run>

Remove runs with two clusters more similar than this correlation

--min-marcd-run <min_marcd_run>

Remove runs with two clusters that differ by less than this MARCD

--max-arcd-vs-ens-avg <max_arcd_vs_ens_avg>

Remove runs where a cluster differs by more than this ARCD from the ensemble average at any position

--max-gini-run <max_gini_run>

Remove runs where any cluster’s Gini coefficient exceeds this limit

--jackpot, --no-jackpot

Calculate the jackpotting quotient to find over-represented reads

--jackpot-conf-level <jackpot_conf_level>

Confidence level for the jackpotting quotient confidence interval

--max-jackpot-quotient <max_jackpot_quotient>

Remove runs whose jackpotting quotient exceeds this limit

--max-jackpot-sims <max_jackpot_sims>

Maximum number of simulations to compute the jackpotting quotient

--jackpot-max-data <jackpot_max_data>

Skip calculating the jackpotting quotient if the reads × positions exceeds this limit

--max-loglike-vs-best <max_loglike_vs_best>

Remove Ks with a log likelihood gap larger than this (0 for no limit)

--min-pearson-vs-best <min_pearson_vs_best>

Remove Ks where every run has less than this correlation vs. the best

--max-marcd-vs-best <max_marcd_vs_best>

Remove Ks where every run has more than this MARCD vs. the best

--try-all-ks, --stop-best-k

Try all numbers of clusters (Ks), even after finding the best number

--write-all-ks, --write-best-k

Write all numbers of clusters (Ks), rather than only the best number

--cluster-pos-table, --no-cluster-pos-table

Tabulate relationships per position for cluster data

--cluster-abundance-table, --no-cluster-abundance-table

Tabulate number of reads per cluster for cluster data

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--brotli-level <brotli_level>

Compress pickle files with this level of Brotli (0 - 11)

--self-contained, --no-self-contained

Write self-contained batch files that skip loading predecessor batches (Filter/Cluster steps); costs more disk space

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--keep-tmp, --erase-tmp

Keep temporary files after finishing

--seed <seed>

Seed for the random number generator

--validate-gaps, --no-validate-gaps

In clusterscan, test each gap between domains for independence and merge failing gaps; off by default (expensive)

--gap-min-assoc <gap_min_assoc>

Minimum deviation of fitted joint cluster proportions from independence to keep a gap unmerged; higher merges fewer gaps

Arguments

INPUT_PATH

Optional argument(s)

seismic table

Tabulate counts of relationships per read and position.

Usage

seismic table [OPTIONS] [INPUT_PATH]...

Options

--idmut-pos-table, --no-idmut-pos-table

Tabulate relationships per position for idmut data

--idmut-read-table, --no-idmut-read-table

Tabulate relationships per read for idmut data

--filter-pos-table, --no-filter-pos-table

Tabulate relationships per position for filter data

--filter-read-table, --no-filter-read-table

Tabulate relationships per read for filter data

--cluster-pos-table, --no-cluster-pos-table

Tabulate relationships per position for cluster data

--cluster-abundance-table, --no-cluster-abundance-table

Tabulate number of reads per cluster for cluster data

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

Arguments

INPUT_PATH

Optional argument(s)

seismic duplex

Combine two references into a duplex for cofolding.

Usage

seismic duplex [OPTIONS] [INPUT_PATH]...

Options

--duplex-pair, --no-duplex-pair

Duplex every pair of input profiles

--dimer, --no-dimer

Duplex each input profile with itself, to model a homodimer

--duplex-file <duplex_file>

Duplex each input profile with the sequences in this FASTA file (the second strand of each duplex, without any mutational data)

--duplex-sequence <duplex_sequence>

Duplex each input profile with a named strand given as its name and its raw sequence 5’ to 3’ (e.g. –duplex-sequence ASO ATTCACTTTCATAATGCTGG); this second strand carries no mutational data

--duplex-table-region, --duplex-full

Default for every strand: build it from only the source table’s region (–duplex-table-region), or from its full reference sequence with the table’s data mapped onto that region (–duplex-full, the default)

--duplex-full-ref <duplex_full_ref>

Build the strand for this reference from its full reference sequence, overriding –duplex-full/–duplex-table-region for it (repeatable)

--duplex-region-ref <duplex_region_ref>

Build the strand for this reference from only its table region, overriding –duplex-full/–duplex-table-region for it (repeatable)

-b, --branch <branch>

Create a new branch of the workflow with this name

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

Arguments

INPUT_PATH

Optional argument(s)

seismic fold

Predict RNA secondary structures using mutation rates.

Usage

seismic fold [OPTIONS] [INPUT_PATH]...

Options

-b, --branch <branch>

Create a new branch of the workflow with this name

-F, --fold-regions-file <fold_regions_file>

Fold regions of references from coordinates/primers in a CSV file

--fold-coords <fold_coords>

Fold a region of a reference given its 5’ and 3’ end coordinates

--fold-primers <fold_primers>

Fold a region of a reference given its forward and reverse primers

--fold-table-region, --fold-full-region

If no regions are specified, whether to default to the table’s region or to the full region

--fold-dry-run, --fold-real-run

Only generate the fold command and input files; do not run folding

--fold-backend <fold_backend>

Model RNA structures using RNAstructure (Fold/ShapeKnots) or ViennaRNA (RNAfold/RNAsubopt); auto selects RNAstructure for DMS and ViennaRNA for other probes

Options:

auto | RNAstructure | ViennaRNA

--pseudoknots, --no-pseudoknots

Predict pseudoknotted structures (requires –fold-backend=RNAstructure; uses ShapeKnots when set, Fold otherwise)

--fold-energy-method <fold_energy_method>

Use this method to incorporate reactivities into folding energies. auto selects Cordero for DMS and Eddy for other probes; Eddy requires –fold-backend=ViennaRNA; Cordero requires –fold-backend=RNAstructure

Options:

auto | Deigan | Cordero | Eddy

--fold-temp <fold_temp>

Predict structures at this temperature (Celsius)

--deigan-slope <deigan_slope>

Slope (kcal/mol) for SHAPE reactivities using Deigan method; used only with –fold-energy-method=Deigan

--deigan-intercept <deigan_intercept>

Intercept (kcal/mol) for SHAPE reactivities using Deigan method; used only with –fold-energy-method=Deigan

--fold-quantile <fold_quantile>

Normalize and winsorize reactivities to this quantile for folding

--fold-fpaired <fold_fpaired>

Assume this fraction of bases is paired when computing Cordero pseudoenergies for cofolding

--fold-constraint <fold_constraint>

Force bases to be paired/unpaired from a file of constraints

--fold-commands <fold_commands>

Command file for RNAFold

--eddy-prior-paired-file <eddy_prior_paired_file>

File of per-position prior probabilities of being paired for the Eddy method (passed as –sp-data with –sp-strategy Pp); only used with –fold-energy-method=Eddy and –fold-backend=ViennaRNA

--eddy-prior-unpaired-file <eddy_prior_unpaired_file>

File of per-position prior probabilities of being unpaired for the Eddy method (passed as –sp-data with –sp-strategy Pu); only used with –fold-energy-method=Eddy and –fold-backend=ViennaRNA

--fold-md <fold_md>

Limit base pair distances to this number of bases (0 for no limit)

--fold-mfe, --fold-sub

Predict only the minimum free energy (MFE) structure

--fold-max <fold_max>

Output at most this many structures (overriden by –fold-mfe)

--fold-percent <fold_percent>

Stop outputting structures when the % difference in energy exceeds this value (overriden by –fold-mfe)

--fold-edelta <fold_edelta>

Maximum energy difference (kcal/mol) from the MFE for suboptimal structures from RNAsubopt (overriden by –fold-mfe)

--fold-isolated, --fold-stacked

Allow isolated (non-stacked) base pairs when folding

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--keep-tmp, --erase-tmp

Keep temporary files after finishing

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

Arguments

INPUT_PATH

Optional argument(s)

seismic graph

seismic graph profile

Bar graph of relationships(s) per position.

Usage

seismic graph profile [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--use-ratio, --use-count

Graph ratios or counts

-r, --rels <rels>

Graph these relationship(s)

--graph-quantile <graph_quantile>

Normalize and winsorize ratios to this quantile (0 disables)

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph delprof

Bar graph of differences between two profiles per position.

Usage

seismic graph delprof [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--use-ratio, --use-count

Graph ratios or counts

-r, --rels <rels>

Graph these relationship(s)

--graph-quantile <graph_quantile>

Normalize and winsorize ratios to this quantile (0 disables)

--comppair, --no-comppair

Compare every pair of table files

--compself, --no-compself

Compare every table file with itself

-o, --out-dir <out_dir>

Write all output files to this directory

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph scatter

Scatter plot comparing two profiles.

Usage

seismic graph scatter [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--use-ratio, --use-count

Graph ratios or counts

-r, --rels <rels>

Graph these relationship(s)

--graph-quantile <graph_quantile>

Normalize and winsorize ratios to this quantile (0 disables)

--comppair, --no-comppair

Compare every pair of table files

--compself, --no-compself

Compare every table file with itself

-o, --out-dir <out_dir>

Write all output files to this directory

-m, --metric <metric>

Metric to compare mutation rates: ‘pcc’ = Pearson correlation coefficient (r), ‘scc’ = Spearman correlation coefficient (ρ), ‘r2’ = coefficient of determination (R²), ‘marcd’ = mean arcsine distance (MARCD)

Options:

marcd | pcc | scc | r2

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph corroll

Rolling correlation/comparison of two profiles.

Usage

seismic graph corroll [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--use-ratio, --use-count

Graph ratios or counts

-r, --rels <rels>

Graph these relationship(s)

--graph-quantile <graph_quantile>

Normalize and winsorize ratios to this quantile (0 disables)

--window <window>

Use a sliding window of this many bases

-n, --winmin <winmin>

Mask sliding windows with fewer than this number of data

--comppair, --no-comppair

Compare every pair of table files

--compself, --no-compself

Compare every table file with itself

-o, --out-dir <out_dir>

Write all output files to this directory

-m, --metric <metric>

Metric to compare mutation rates: ‘pcc’ = Pearson correlation coefficient (r), ‘scc’ = Spearman correlation coefficient (ρ), ‘r2’ = coefficient of determination (R²), ‘marcd’ = mean arcsine distance (MARCD)

Options:

marcd | pcc | scc | r2

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph giniroll

Rolling Gini coefficient.

Usage

seismic graph giniroll [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--use-ratio, --use-count

Graph ratios or counts

-r, --rels <rels>

Graph these relationship(s)

--graph-quantile <graph_quantile>

Normalize and winsorize ratios to this quantile (0 disables)

--window <window>

Use a sliding window of this many bases

-n, --winmin <winmin>

Mask sliding windows with fewer than this number of data

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph snrroll

Rolling signal-to-noise ratio.

Usage

seismic graph snrroll [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--use-ratio, --use-count

Graph ratios or counts

-r, --rels <rels>

Graph these relationship(s)

--graph-quantile <graph_quantile>

Normalize and winsorize ratios to this quantile (0 disables)

--window <window>

Use a sliding window of this many bases

-n, --winmin <winmin>

Mask sliding windows with fewer than this number of data

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph histpos

Histogram of relationship(s) per position.

Usage

seismic graph histpos [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--use-ratio, --use-count

Graph ratios or counts

-r, --rels <rels>

Graph these relationship(s)

--graph-quantile <graph_quantile>

Normalize and winsorize ratios to this quantile (0 disables)

--hist-bins <hist_bins>

Number of bins in each histogram; must be ≥ 1

--hist-margin <hist_margin>

Autofill margins of at most this width in histograms of ratios

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph histread

Histogram of relationship(s) per read.

Usage

seismic graph histread [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--use-ratio, --use-count

Graph ratios or counts

-r, --rels <rels>

Graph these relationship(s)

--graph-quantile <graph_quantile>

Normalize and winsorize ratios to this quantile (0 disables)

--hist-bins <hist_bins>

Number of bins in each histogram; must be ≥ 1

--hist-margin <hist_margin>

Autofill margins of at most this width in histograms of ratios

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph mutdist

Distance between the closest two mutations in each read.

Usage

seismic graph mutdist [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

-r, --rels <rels>

Graph these relationship(s)

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--mutdist-null, --no-mutdist-null

Include the null distribution of distances between mutations

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph poscorr

Phi correlations between pairs of positions.

Usage

seismic graph poscorr [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

-r, --rels <rels>

Graph these relationship(s)

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph roc

ROC curve comparing a profile to a structure.

Usage

seismic graph roc [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--use-ratio, --use-count

Graph ratios or counts

-r, --rels <rels>

Graph these relationship(s)

--graph-quantile <graph_quantile>

Normalize and winsorize ratios to this quantile (0 disables)

--struct-file <struct_file>

Compare mutational profiles to the structure(s) in this CT file

-b, --branch <branch>

Create a new branch of the workflow with this name

-F, --fold-regions-file <fold_regions_file>

Fold regions of references from coordinates/primers in a CSV file

--fold-coords <fold_coords>

Fold a region of a reference given its 5’ and 3’ end coordinates

--fold-primers <fold_primers>

Fold a region of a reference given its forward and reverse primers

--fold-table-region, --fold-full-region

If no regions are specified, whether to default to the table’s region or to the full region

--terminal-pairs, --no-terminal-pairs

Include terminal base pairs (at the ends of stems) in ROC curves

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph aucroll

Rolling AUC-ROC comparing a profile to a structure.

Usage

seismic graph aucroll [OPTIONS] [INPUT_PATH]...

Options

--cgroup <cgroup>

Put each Cluster in its own file, each K in its own file, or All clusters in one file

Options:

c | k | a

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--use-ratio, --use-count

Graph ratios or counts

-r, --rels <rels>

Graph these relationship(s)

--graph-quantile <graph_quantile>

Normalize and winsorize ratios to this quantile (0 disables)

--struct-file <struct_file>

Compare mutational profiles to the structure(s) in this CT file

-b, --branch <branch>

Create a new branch of the workflow with this name

-F, --fold-regions-file <fold_regions_file>

Fold regions of references from coordinates/primers in a CSV file

--fold-coords <fold_coords>

Fold a region of a reference given its 5’ and 3’ end coordinates

--fold-primers <fold_primers>

Fold a region of a reference given its forward and reverse primers

--fold-table-region, --fold-full-region

If no regions are specified, whether to default to the table’s region or to the full region

--terminal-pairs, --no-terminal-pairs

Include terminal base pairs (at the ends of stems) in ROC curves

--window <window>

Use a sliding window of this many bases

-n, --winmin <winmin>

Mask sliding windows with fewer than this number of data

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic graph abundance

Abundance of each cluster.

Usage

seismic graph abundance [OPTIONS] [INPUT_PATH]...

Options

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--use-ratio, --use-count

Graph ratios or counts

--csv, --no-csv

Output the data for each graph in a Comma-Separated Values file

--html, --no-html

Output each graph in an interactive HyperText Markup Language file

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic draw

Draw RNA structures with reactivities using RNArtistCore.

Usage

seismic draw [OPTIONS] [INPUT_PATH]...

Options

--fold-table-region, --fold-full-region

If no regions are specified, whether to default to the table’s region or to the full region

--struct-num <struct_num>

Draw the specified structure (zero-indexed) or -1 for all; by default, draws the structure with the best AUROC.

--color, --no-color

Color bases by their reactivity

--draw-svg, --no-draw-svg

Output each drawing in a Scalable Vector Graphics file

--draw-png, --no-draw-png

Output each drawing in a Portable Network Graphics file

--update-rnartistcore, --no-update-rnartistcore

Check for and install updates to RNArtistCore.

--force, --no-force

Force all tasks to run, overwriting any existing output files

--keep-tmp, --erase-tmp

Keep temporary files after finishing

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic collate

Collate HTML graphs and SVG drawings into an HTML report file.

Usage

seismic collate [OPTIONS] [INPUT_PATH]...

Options

--name <name>

Prefix the HTML report with this name.

--verbose-name, --no-verbose-name

Add collated file information to report name.

--collate-out-dir <collate_out_dir>

Write collated report to this directory. By default, write to the lowest level directory common to all input graphs.

--include-svg, --no-include-svg

Include RNA structure drawings from the draw module.

--include-graph, --no-include-graph

Include graphs from the graph module.

--group <group>

Group collated graphs by one of ‘sample’, ‘graph’, ‘branches’, ‘region’, or ‘all’.

--portable, --no-portable

Embed collated graphs into the output HTML file for portability at the expense of live updates and file size.

--force, --no-force

Force all tasks to run, overwriting any existing output files

Arguments

INPUT_PATH

Optional argument(s)

seismic export

Export each sample to SEISMICgraph (https://seismicrna.org).

Usage

seismic export [OPTIONS] [INPUT_PATH]...

Options

-S, --samples-meta <samples_meta>

Add sample metadata from this CSV file to exported results

-R, --refs-meta <refs_meta>

Add reference metadata from this CSV file to exported results

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--all-pos, --unmasked-pos

Export all positions (not just unmasked positions)

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

Utility commands

seismic splitbam

Split a BAM file into one file for each reference.

Usage

seismic splitbam [OPTIONS] FASTA [INPUT_PATH]...

Options

--phred-enc <phred_enc>

Specify the Phred score encoding of FASTQ and SAM/BAM/CRAM files

-o, --out-dir <out_dir>

Write all output files to this directory

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--force, --no-force

Force all tasks to run, overwriting any existing output files

--keep-tmp, --erase-tmp

Keep temporary files after finishing

-b, --branch <branch>

Create a new branch of the workflow with this name

--bt2-local, --bt2-end-to-end

Align reads in local mode rather than end-to-end mode

--bt2-discordant, --bt2-no-discordant

Output paired-end reads whose mates align discordantly

--bt2-mixed, --bt2-no-mixed

Attempt to align individual mates of pairs that fail to align

--bt2-dovetail, --bt2-no-dovetail

Consider dovetailed mate pairs to align concordantly

--bt2-contain, --bt2-no-contain

Consider nested mate pairs to align concordantly

--bt2-I <bt2_i>

Discard paired-end alignments shorter than this many bases

--bt2-X <bt2_x>

Discard paired-end alignments longer than this many bases

--bt2-score-min-loc <bt2_score_min_loc>

Discard alignments that score below this threshold in local mode

--bt2-score-min-e2e <bt2_score_min_e2e>

Discard alignments that score below this threshold in end-to-end mode

--bt2-i <bt2_s>

Seed Bowtie2 alignments at this interval

--bt2-L <bt2_l>

Use this seed length for Bowtie2

--bt2-D <bt2_d>

Discard alignments if over this many consecutive seed extensions fail

--bt2-R <bt2_r>

Re-seed reads with repetitive seeds up to this many times

--bt2-gbar <bt2_gbar>

Do not place gaps within this many bases from the end of a read

--bt2-dpad <bt2_dpad>

Pad the alignment matrix with this many bases (to allow gaps)

--bt2-orient <bt2_orient>

Require paired mates to have this orientation

Options:

fr | rf | ff

--seed <seed>

Seed for the random number generator

--min-mapq <min_mapq>

Discard reads with mapping qualities below this threshold

-N, --min-reads <min_reads>

Discard alignment maps with fewer than this many reads

--sep-strands, --mix-strands

Separate each alignment map into forward- and reverse-strand reads

--f1r2-fwd, --f1r2-rev

With –sep-strands, consider forward mate 1s and reverse mate 2s to be forward-stranded

--rev-label <rev_label>

With –sep-strands, add this label to each reverse-strand reference

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

Arguments

FASTA

Required argument

INPUT_PATH

Optional argument(s)

seismic cleanfa

Clean the names and sequences in FASTA files.

Usage

seismic cleanfa [OPTIONS] [INPUT_PATH]...

Options

--inplace, --no-inplace

Modify files in-place instead of writing new files (CAUTION: you cannot recover the original files afterwards)

-o, --out-dir <out_dir>

Write all output files to this directory

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic list

List positions to mask.

Usage

seismic list [OPTIONS] [INPUT_PATH]...

Options

-b, --branch <branch>

Create a new branch of the workflow with this name

--min-ninfo-pos <min_ninfo_pos>

Mask positions with fewer than this many informative base calls

--max-fmut-pos <max_fmut_pos>

Mask positions with more than this fraction of mutated base calls

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic renumct

Renumber connectivity table (CT) files given a 5’ position.

Usage

seismic renumct [OPTIONS]

Options

--ct-pos-5 <ct_pos_5>

Connectivity table (CT) file or directory of CT files and the 5’ position to assign to each file

--inplace, --no-inplace

Modify files in-place instead of writing new files (CAUTION: you cannot recover the original files afterwards)

-o, --out-dir <out_dir>

Write all output files to this directory

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

seismic ct2db

Convert connectivity table (CT) to dot-bracket (DB) files.

Usage

seismic ct2db [OPTIONS] [INPUT_PATH]...

Options

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic db2ct

Convert dot-bracket (DB) to connectivity table (CT) files.

Usage

seismic db2ct [OPTIONS] [INPUT_PATH]...

Options

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic importmm

Import RNA Framework Mutation Map (MM) files as IDmut outputs.

Usage

seismic importmm [OPTIONS] [INPUT_PATH]...

Options

-o, --out-dir <out_dir>

Write all output files to this directory

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

-b, --branch <branch>

Create a new branch of the workflow with this name

-s, --sample <sample>

Required Give this name to the imported sample

-N, --min-reads <min_reads>

Discard alignment maps with fewer than this many reads

--batch-size <batch_size>

Limit batches to at most this many reads

--insert3, --insert5

Mark each insertion on the base to its 3’ (True) or 5’ (False) side

--brotli-level <brotli_level>

Compress pickle files with this level of Brotli (0 - 11)

--write-read-names, --no-write-read-names

Write the name of each read in a second set of batches (necessary for the options –drop-read or –drop-read-file)

--idmut-pos-table, --no-idmut-pos-table

Tabulate relationships per position for idmut data

--idmut-read-table, --no-idmut-read-table

Tabulate relationships per read for idmut data

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

Arguments

INPUT_PATH

Optional argument(s)

seismic migrate

Migrate output directories from v0.24 to v0.25

Usage

seismic migrate [OPTIONS] [INPUT_PATH]...

Options

-o, --out-dir <out_dir>

Write all output files to this directory

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)

seismic fold datapath

Guess the DATAPATH for RNAstructure.

Usage

seismic fold datapath [OPTIONS]

seismic test

Run all unit tests.

Usage

seismic test [OPTIONS]

Options

-v, --verbose

Log more messages (-v for debug, -vv for trace) on stderr

seismic sim

seismic sim total

Simulate FASTQ files from scratch.

Usage

seismic sim total [OPTIONS]

Options

--max-tries <max_tries>

Simulate the parameters with up to this many attempts

--mask-a, --keep-a

Mask positions with base A

--mask-c, --keep-c

Mask positions with base C

--mask-g, --keep-g

Mask positions with base G

--mask-u, --keep-u

Mask positions with base U

--mask-polya <mask_polya>

Mask stretches of at least this many consecutive A bases (0 disables); defaults to 5 for chemical probes, 0 for none

--max-fraction-ident <max_fraction_ident>

Retry if any two clusters have more than this fraction of identical mutation rates

--max-pearson-sim <max_pearson_sim>

Retry if any two clusters have a Pearson correlation larger than this

--min-marcd-sim <min_marcd_sim>

Retry if any two clusters have a MARCD less than this (0 disables)

--profile-name <profile_name>

Give the simulated structure and parameters this profile name

-s, --sample <sample>

Give this name to the simulated sample

--paired-end, --single-end

Simulate paired-end or single-end reads

--read-length <read_length>

Simulate reads with this many base calls

--reverse-fraction <reverse_fraction>

Simulate this fraction of reverse-oriented reads

--probe <probe>

Use the default options for this chemical probe

Options:

DMS | SHAPE | ETC | none

--min-mut-gap-weights <min_mut_gap_weights>

Comma-separated gap:weight pairs for a mixture of min_mut_gap biases, e.g. ‘0:0.2,1:0.3,2:0.5’ (empty string disables)

--mut-collisions <mut_collisions>

If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.

Options:

drop | merge | auto

--injected-mut-probs <injected_mut_probs>

Comma-separated offset:prob pairs (offset ≥ 1): odds of a mutation offset positions 5’ of one, e.g. ‘1:0.1,2:0.01’

--fq-gzip, --fq-text

Simulate FASTQ files with gzip compression or as plain text

--num-reads <num_reads>

Simulate this many reads

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

--seed <seed>

Seed for the random number generator

--sim-dir <sim_dir>

Write all simulated files to this directory

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--fold-backend <fold_backend>

Model RNA structures using RNAstructure (Fold/ShapeKnots) or ViennaRNA (RNAfold/RNAsubopt); auto selects RNAstructure for DMS and ViennaRNA for other probes

Options:

auto | RNAstructure | ViennaRNA

--pseudoknots, --no-pseudoknots

Predict pseudoknotted structures (requires –fold-backend=RNAstructure; uses ShapeKnots when set, Fold otherwise)

-F, --fold-regions-file <fold_regions_file>

Fold regions of references from coordinates/primers in a CSV file

--fold-coords <fold_coords>

Fold a region of a reference given its 5’ and 3’ end coordinates

--fold-primers <fold_primers>

Fold a region of a reference given its forward and reverse primers

--fold-constraint <fold_constraint>

Force bases to be paired/unpaired from a file of constraints

--fold-temp <fold_temp>

Predict structures at this temperature (Celsius)

--fold-md <fold_md>

Limit base pair distances to this number of bases (0 for no limit)

--fold-mfe, --fold-sub

Predict only the minimum free energy (MFE) structure

--fold-max <fold_max>

Output at most this many structures (overriden by –fold-mfe)

--fold-min <fold_min>

Require at least this many structures (overriden by –fold-mfe)

--fold-percent <fold_percent>

Stop outputting structures when the % difference in energy exceeds this value (overriden by –fold-mfe)

--fold-edelta <fold_edelta>

Maximum energy difference (kcal/mol) from the MFE for suboptimal structures from RNAsubopt (overriden by –fold-mfe)

--keep-tmp, --erase-tmp

Keep temporary files after finishing

--clust-conc <clust_conc>

Set the concentration parameter for simulating cluster proportions

--center-fmean <center_fmean>

Set the mean read center as a fraction of the region length

--center-fvar <center_fvar>

Set the variance of the read center as a fraction of its maximum

--length-fmean <length_fmean>

Set the mean read length as a fraction of the region length

--length-fvar <length_fvar>

Set the variance of the read length as a fraction of its maximum

-p, --pmut-paired <pmut_paired>

Set the mean rate of each kind of mutation for paired bases

-u, --pmut-unpaired <pmut_unpaired>

Set the mean rate of each kind of mutation for unpaired bases

-v, --vmut-paired <vmut_paired>

Set the relative variance of mutation rates of each kind of paired base

-w, --vmut-unpaired <vmut_unpaired>

Set the relative variance of mutation rates of each kind of unpaired base

-c, --region-coords <region_coords>

Select a region of a reference given its 5’ and 3’ end coordinates

-P, --region-primers <region_primers>

Select a region of a reference given its forward and reverse primers

--refs <refs>

Give this name to the file of simulated references

--ref <ref>

Give this name to the simulated reference

--reflen <reflen>

Simulate a reference sequence with this many bases

seismic sim ref

Simulate a FASTA file of a reference sequence.

Usage

seismic sim ref [OPTIONS]

Options

--sim-dir <sim_dir>

Write all simulated files to this directory

--refs <refs>

Give this name to the file of simulated references

--ref <ref>

Give this name to the simulated reference

--reflen <reflen>

Simulate a reference sequence with this many bases

--force, --no-force

Force all tasks to run, overwriting any existing output files

--seed <seed>

Seed for the random number generator

seismic sim fold

Simulate secondary structure(s) a reference sequence.

Usage

seismic sim fold [OPTIONS] FASTA

Options

--sim-dir <sim_dir>

Write all simulated files to this directory

-t, --tmp-pfx <tmp_pfx>

Write all temporary files to a directory with this prefix

--profile-name <profile_name>

Give the simulated structure and parameters this profile name

--probe <probe>

Use the default options for this chemical probe

Options:

DMS | SHAPE | ETC | none

--fold-backend <fold_backend>

Model RNA structures using RNAstructure (Fold/ShapeKnots) or ViennaRNA (RNAfold/RNAsubopt); auto selects RNAstructure for DMS and ViennaRNA for other probes

Options:

auto | RNAstructure | ViennaRNA

--pseudoknots, --no-pseudoknots

Predict pseudoknotted structures (requires –fold-backend=RNAstructure; uses ShapeKnots when set, Fold otherwise)

-F, --fold-regions-file <fold_regions_file>

Fold regions of references from coordinates/primers in a CSV file

--fold-coords <fold_coords>

Fold a region of a reference given its 5’ and 3’ end coordinates

--fold-primers <fold_primers>

Fold a region of a reference given its forward and reverse primers

--fold-constraint <fold_constraint>

Force bases to be paired/unpaired from a file of constraints

--fold-temp <fold_temp>

Predict structures at this temperature (Celsius)

--fold-md <fold_md>

Limit base pair distances to this number of bases (0 for no limit)

--fold-mfe, --fold-sub

Predict only the minimum free energy (MFE) structure

--fold-max <fold_max>

Output at most this many structures (overriden by –fold-mfe)

--fold-min <fold_min>

Require at least this many structures (overriden by –fold-mfe)

--fold-percent <fold_percent>

Stop outputting structures when the % difference in energy exceeds this value (overriden by –fold-mfe)

--fold-edelta <fold_edelta>

Maximum energy difference (kcal/mol) from the MFE for suboptimal structures from RNAsubopt (overriden by –fold-mfe)

--keep-tmp, --erase-tmp

Keep temporary files after finishing

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

FASTA

Required argument

seismic sim params

Simulate parameter files.

Usage

seismic sim params [OPTIONS]

Options

--ct-file <ct_file>

Simulate parameters using the structure(s) in this CT file

--clust-conc <clust_conc>

Set the concentration parameter for simulating cluster proportions

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--seed <seed>

Seed for the random number generator

--center-fmean <center_fmean>

Set the mean read center as a fraction of the region length

--center-fvar <center_fvar>

Set the variance of the read center as a fraction of its maximum

--length-fmean <length_fmean>

Set the mean read length as a fraction of the region length

--length-fvar <length_fvar>

Set the variance of the read length as a fraction of its maximum

-p, --pmut-paired <pmut_paired>

Set the mean rate of each kind of mutation for paired bases

-u, --pmut-unpaired <pmut_unpaired>

Set the mean rate of each kind of mutation for unpaired bases

-v, --vmut-paired <vmut_paired>

Set the relative variance of mutation rates of each kind of paired base

-w, --vmut-unpaired <vmut_unpaired>

Set the relative variance of mutation rates of each kind of unpaired base

--probe <probe>

Use the default options for this chemical probe

Options:

DMS | SHAPE | ETC | none

-c, --region-coords <region_coords>

Select a region of a reference given its 5’ and 3’ end coordinates

-P, --region-primers <region_primers>

Select a region of a reference given its forward and reverse primers

seismic sim muts

Simulate the rate of each kind of mutation at each position.

Usage

seismic sim muts [OPTIONS]

Options

--ct-file <ct_file>

Simulate parameters using the structure(s) in this CT file

-p, --pmut-paired <pmut_paired>

Set the mean rate of each kind of mutation for paired bases

-u, --pmut-unpaired <pmut_unpaired>

Set the mean rate of each kind of mutation for unpaired bases

-v, --vmut-paired <vmut_paired>

Set the relative variance of mutation rates of each kind of paired base

-w, --vmut-unpaired <vmut_unpaired>

Set the relative variance of mutation rates of each kind of unpaired base

--probe <probe>

Use the default options for this chemical probe

Options:

DMS | SHAPE | ETC | none

-c, --region-coords <region_coords>

Select a region of a reference given its 5’ and 3’ end coordinates

-P, --region-primers <region_primers>

Select a region of a reference given its forward and reverse primers

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--seed <seed>

Seed for the random number generator

seismic sim ends

Simulate the proportions of 5’ and 3’ end coordinates.

Usage

seismic sim ends [OPTIONS]

Options

--ct-file <ct_file>

Simulate parameters using the structure(s) in this CT file

--center-fmean <center_fmean>

Set the mean read center as a fraction of the region length

--center-fvar <center_fvar>

Set the variance of the read center as a fraction of its maximum

--length-fmean <length_fmean>

Set the mean read length as a fraction of the region length

--length-fvar <length_fvar>

Set the variance of the read length as a fraction of its maximum

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

seismic sim clusts

Simulate the proportions of 5’ and 3’ end coordinates.

Usage

seismic sim clusts [OPTIONS]

Options

--ct-file <ct_file>

Simulate parameters using the structure(s) in this CT file

--clust-conc <clust_conc>

Set the concentration parameter for simulating cluster proportions

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--seed <seed>

Seed for the random number generator

seismic sim idmut

Simulate an IDmut dataset.

Usage

seismic sim idmut [OPTIONS]

Options

-d, --param-dir <param_dir>

Simulate data using parameter files in this directory

--profile-name <profile_name>

Give the simulated structure and parameters this profile name

-s, --sample <sample>

Give this name to the simulated sample

-b, --branch <branch>

Create a new branch of the workflow with this name

--paired-end, --single-end

Simulate paired-end or single-end reads

--read-length <read_length>

Simulate reads with this many base calls

--reverse-fraction <reverse_fraction>

Simulate this fraction of reverse-oriented reads

--probe <probe>

Use the default options for this chemical probe

Options:

DMS | SHAPE | ETC | none

--min-mut-gap-weights <min_mut_gap_weights>

Comma-separated gap:weight pairs for a mixture of min_mut_gap biases, e.g. ‘0:0.2,1:0.3,2:0.5’ (empty string disables)

--mut-collisions <mut_collisions>

If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.

Options:

drop | merge | auto

--injected-mut-probs <injected_mut_probs>

Comma-separated offset:prob pairs (offset ≥ 1): odds of a mutation offset positions 5’ of one, e.g. ‘1:0.1,2:0.01’

--num-reads <num_reads>

Simulate this many reads

--batch-size <batch_size>

Limit batches to at most this many reads

--write-read-names, --no-write-read-names

Write the name of each read in a second set of batches (necessary for the options –drop-read or –drop-read-file)

--brotli-level <brotli_level>

Compress pickle files with this level of Brotli (0 - 11)

--force, --no-force

Force all tasks to run, overwriting any existing output files

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--seed <seed>

Seed for the random number generator

seismic sim fastq

Simulate a FASTQ file.

Usage

seismic sim fastq [OPTIONS] [INPUT_PATH]...

Options

-d, --param-dir <param_dir>

Simulate data using parameter files in this directory

--profile-name <profile_name>

Give the simulated structure and parameters this profile name

-s, --sample <sample>

Give this name to the simulated sample

--paired-end, --single-end

Simulate paired-end or single-end reads

--read-length <read_length>

Simulate reads with this many base calls

--reverse-fraction <reverse_fraction>

Simulate this fraction of reverse-oriented reads

--probe <probe>

Use the default options for this chemical probe

Options:

DMS | SHAPE | ETC | none

--min-mut-gap-weights <min_mut_gap_weights>

Comma-separated gap:weight pairs for a mixture of min_mut_gap biases, e.g. ‘0:0.2,1:0.3,2:0.5’ (empty string disables)

--mut-collisions <mut_collisions>

If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.

Options:

drop | merge | auto

--injected-mut-probs <injected_mut_probs>

Comma-separated offset:prob pairs (offset ≥ 1): odds of a mutation offset positions 5’ of one, e.g. ‘1:0.1,2:0.01’

--fq-gzip, --fq-text

Simulate FASTQ files with gzip compression or as plain text

--num-reads <num_reads>

Simulate this many reads

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

--force, --no-force

Force all tasks to run, overwriting any existing output files

--seed <seed>

Seed for the random number generator

Arguments

INPUT_PATH

Optional argument(s)

seismic sim abstract

Abstract simulation parameters from tables and structures.

Usage

seismic sim abstract [OPTIONS] [INPUT_PATH]...

Options

--fold-table-region, --fold-full-region

If no regions are specified, whether to default to the table’s region or to the full region

-F, --fold-regions-file <fold_regions_file>

Fold regions of references from coordinates/primers in a CSV file

--fold-coords <fold_coords>

Fold a region of a reference given its 5’ and 3’ end coordinates

--fold-primers <fold_primers>

Fold a region of a reference given its forward and reverse primers

--struct-file <struct_file>

Compare mutational profiles to the structure(s) in this CT file

-b, --branch <branch>

Create a new branch of the workflow with this name

--min-aucroc <min_aucroc>

Skip tables/profiles where the AUC-ROC is less than this value

--verify-times, --no-verify-times

Verify that report files from later steps have later timestamps

--num-cpus <num_cpus>

Use up to this many CPUs simultaneously

Arguments

INPUT_PATH

Optional argument(s)