Command Line Reference
Note
All subcommands, arguments, and options listed in these documents can be
printed, along with a short explanation of each, on the command line by
running seismic [command(s)] --help.
For example,
seismic --help prints all options and subcommands for the command
seismic,
seismic graph --help prints all options and subcommands for the command
seismic graph, and
seismic graph profile --help prints all options and subcommands for the
command seismic graph profile.
Run the entire workflow
seismic wf
Run the entire workflow.
Usage
seismic wf [OPTIONS] FASTA [INPUT_PATH]...
Options
- --wf-branch <wf_branch>
Run a step under a new branch: give the step name then the branch name (used multiple times to branch several steps)
- --demult, --no-demult
Enable demultiplexing
- -x, --fastqx <fastqx>
FASTQ files of paired-end reads with mates 1 and 2 in separate files
- -y, --fastqy <fastqy>
FASTQ file(s) of paired-end reads with mates 1 and 2 interleaved
- -z, --fastqz <fastqz>
FASTQ file(s) of single-end reads
- -X, --dmfastqx <dmfastqx>
Demultiplexed FASTQ files of mate 1 and mate 2 reads
- -Y, --dmfastqy <dmfastqy>
Demultiplexed FASTQ files of paired-end reads interleaved in one file
- -Z, --dmfastqz <dmfastqz>
Demultiplexed FASTQ files of single-end reads
- --phred-enc <phred_enc>
Specify the Phred score encoding of FASTQ and SAM/BAM/CRAM files
- -R, --refs-meta <refs_meta>
Add reference metadata from this CSV file to exported results
- --barcode-start <barcode_start>
Index of start of barcode
- --barcode-end <barcode_end>
Index of end of barcode
- --read-pos <read_pos>
Expected position of the barcode in the read (1-indexed). Defaults to –barcode-start
- --barcode <barcode>
A list of barcode name, barcode sequence, and barcode position (1-indexed relative to read start) to demultiplex
- --mismatch-tolerance <mismatch_tolerance>
Match patterns with up to this many mismatches (grows factorially; caution above 2; not applied to clipped sequences)
- --index-tolerance <index_tolerance>
Allow patterns to be found in reads up to this distance from the reference index.
- --allow-n, --no-allow-n
Allow N as a valid mismatch when –mismatch-tolerance ≥ 1. Increases memory consumption.
- -o, --out-dir <out_dir>
Write all output files to this directory
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --fastp, --no-fastp
Use fastp to QC, filter, and trim reads before alignment
- --fastp-5, --no-fastp-5
Trim low-quality bases from the 5’ ends of reads
- --fastp-3, --no-fastp-3
Trim low-quality bases from the 3’ ends of reads
- --fastp-w <fastp_w>
Use this window size (nt) for –fastp-5 and –fastp-3
- --fastp-m <fastp_m>
Use this mean quality threshold for –fastp-5 and –fastp-3
- --fastp-poly-g <fastp_poly_g>
Trim poly(G) tails (two-color sequencing artifacts) from the 3’ end
- Options:
yes | no | auto
- --fastp-poly-g-min-len <fastp_poly_g_min_len>
Minimum number of Gs to consider a poly(G) tail for –fastp-poly-g
- --fastp-poly-x, --no-fastp-poly-x
Trim poly(X) tails (i.e. of any nucleotide) from the 3’ end
- --fastp-poly-x-min-len <fastp_poly_x_min_len>
Minimum number of bases to consider a poly(X) tail for –fastp-poly-x
- --fastp-adapter-trimming, --no-fastp-adapter-trimming
Trim adapter sequences from the 3’ ends of reads
- --fastp-adapter-1 <fastp_adapter_1>
Trim this adapter sequence from the 3’ ends of read 1s
- --fastp-adapter-2 <fastp_adapter_2>
Trim this adapter sequence from the 3’ ends of read 2s
- --fastp-adapter-fasta <fastp_adapter_fasta>
Trim adapter sequences in this FASTA file from the 3’ ends of reads
- --fastp-detect-adapter-for-pe, --no-fastp-detect-adapter-for-pe
Automatically detect the adapter sequences for paired-end reads
- --fastp-min-length <fastp_min_length>
Discard reads shorter than this length
- --bt2-local, --bt2-end-to-end
Align reads in local mode rather than end-to-end mode
- --bt2-discordant, --bt2-no-discordant
Output paired-end reads whose mates align discordantly
- --bt2-mixed, --bt2-no-mixed
Attempt to align individual mates of pairs that fail to align
- --bt2-dovetail, --bt2-no-dovetail
Consider dovetailed mate pairs to align concordantly
- --bt2-contain, --bt2-no-contain
Consider nested mate pairs to align concordantly
- --bt2-I <bt2_i>
Discard paired-end alignments shorter than this many bases
- --bt2-X <bt2_x>
Discard paired-end alignments longer than this many bases
- --bt2-score-min-e2e <bt2_score_min_e2e>
Discard alignments that score below this threshold in end-to-end mode
- --bt2-score-min-loc <bt2_score_min_loc>
Discard alignments that score below this threshold in local mode
- --bt2-i <bt2_s>
Seed Bowtie2 alignments at this interval
- --bt2-L <bt2_l>
Use this seed length for Bowtie2
- --bt2-gbar <bt2_gbar>
Do not place gaps within this many bases from the end of a read
- --bt2-D <bt2_d>
Discard alignments if over this many consecutive seed extensions fail
- --bt2-R <bt2_r>
Re-seed reads with repetitive seeds up to this many times
- --bt2-dpad <bt2_dpad>
Pad the alignment matrix with this many bases (to allow gaps)
- --bt2-orient <bt2_orient>
Require paired mates to have this orientation
- Options:
fr | rf | ff
- --bt2-un, --bt2-no-un
Output unaligned reads to a FASTQ file
- --seed <seed>
Seed for the random number generator
- --min-mapq <min_mapq>
Discard reads with mapping qualities below this threshold
- -N, --min-reads <min_reads>
Discard alignment maps with fewer than this many reads
- --sep-strands, --mix-strands
Separate each alignment map into forward- and reverse-strand reads
- --f1r2-fwd, --f1r2-rev
With –sep-strands, consider forward mate 1s and reverse mate 2s to be forward-stranded
- --rev-label <rev_label>
With –sep-strands, add this label to each reverse-strand reference
- --min-phred <min_phred>
Mark base calls with Phred scores lower than this threshold as ambiguous
- --batch-size <batch_size>
Limit batches to at most this many reads
- --insert3, --insert5
Mark each insertion on the base to its 3’ (True) or 5’ (False) side
- --ambindel, --no-ambindel
Mark all ambiguous insertions and deletions (indels)
- --overhangs, --no-overhangs
Retain the overhangs of paired-end mates that dovetail
- -5, --clip-end5 <clip_end5>
Clip this many bases from the 5’ end of each read
- -3, --clip-end3 <clip_end3>
Clip this many bases from the 3’ end of each read
- --brotli-level <brotli_level>
Compress pickle files with this level of Brotli (0 - 11)
- --write-read-names, --no-write-read-names
Write the name of each read in a second set of batches (necessary for the options –drop-read or –drop-read-file)
- --idmut-pos-table, --no-idmut-pos-table
Tabulate relationships per position for idmut data
- --idmut-read-table, --no-idmut-read-table
Tabulate relationships per read for idmut data
- --idmut-cx, --idmut-py
Use the fast C-extension idmut algorithm; the slow Python version is a fallback if the C extension fails to load
- -c, --region-coords <region_coords>
Select a region of a reference given its 5’ and 3’ end coordinates
- -P, --region-primers <region_primers>
Select a region of a reference given its forward and reverse primers
- --primer-gap <primer_gap>
Leave a gap of this many bases between the primer and the region
- -i, --regions-file <regions_file>
Select regions of references from coordinates/primers in a CSV file
- --count-del, --no-del
Count deletions as mutations
- --count-ins, --no-ins
Count insertions as mutations
- --no-mut <no_mut>
Do not count this type of mutation (overrides –count-del/ins)
- --only-mut <only_mut>
Count only this type of mutation (overrides other mutation settings)
- --probe <probe>
Use the default options for this chemical probe
- Options:
DMS | SHAPE | ETC | none
- --mask-a, --keep-a
Mask positions with base A
- --mask-c, --keep-c
Mask positions with base C
- --mask-g, --keep-g
Mask positions with base G
- --mask-u, --keep-u
Mask positions with base U
- --mask-polya <mask_polya>
Mask stretches of at least this many consecutive A bases (0 disables); defaults to 5 for chemical probes, 0 for none
- --mask-pos <mask_pos>
Mask this position in this reference
- --mask-pos-file <mask_pos_file>
Mask positions in references from a file
- --min-ninfo-pos <min_ninfo_pos>
Mask positions with fewer than this many informative base calls
- --max-fmut-pos <max_fmut_pos>
Mask positions with more than this fraction of mutated base calls
- --drop-read <drop_read>
Drop the read with this name
- --drop-read-file <drop_read_file>
Drop the reads with names in this file
- --drop-discontig, --keep-discontig
Drop paired-end reads with discontiguous mates
- --min-ncov-read <min_ncov_read>
Drop reads with fewer than this many bases covering the region
- --min-fcov-read <min_fcov_read>
Drop reads covering less than this fraction of the region
- --min-finfo-read <min_finfo_read>
Drop reads with less than this fraction of informative base calls
- --max-fmut-read <max_fmut_read>
Drop reads with more than this fraction of mutated base calls
- --min-mut-gap <min_mut_gap>
Filter out mutations separated by fewer than this many bases
- --mut-collisions <mut_collisions>
If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.
- Options:
drop | merge | auto
- --quick-unbias, --exact-unbias
Correct observer bias using a quick (typically linear time) heuristic
- --quick-unbias-thresh <quick_unbias_thresh>
Treat mutated fractions under this threshold as 0 with –quick-unbias
- --max-filter-iter <max_filter_iter>
Stop the filter step after this many iterations (0 for no limit)
- --filter-pos-table, --no-filter-pos-table
Tabulate relationships per position for filter data
- --filter-read-table, --no-filter-read-table
Tabulate relationships per read for filter data
- --self-contained, --no-self-contained
Write self-contained batch files that skip loading predecessor batches (Filter/Cluster steps); costs more disk space
- --scan, --no-scan
Scan the RNA for domains (filterscan) and cluster them (clusterscan)
- -L, --tile-length <tile_length>
Make each tile this length (if 0, use 2x the median read length)
- -O, --tile-min-overlap <tile_min_overlap>
Make adjacent tiles overlap by at least this fraction of length
- --erase-tiles, --keep-tiles
Erase the filter reports/batches from the tiling step
- --band-width <band_width>
Consider only position pairs no more than this far apart when finding domains (0 = bounded only by tile length)
- --min-pair-coverage <min_pair_coverage>
Analyze only position pairs with at least this many jointly covering reads (fewer reads are too noisy to score reliably)
- --min-expect-both <min_expect_both>
Analyze only position pairs whose expected both-mutated read count (under independence) is at least this value
- --pair-fdr <pair_fdr>
FDR (Benjamini-Hochberg) for calling a pair a domain-boundary bridge; higher calls more bridges
- --min-fold-change <min_fold_change>
Minimum expected-to-observed both-mutated fold change to call a pair a bridge; higher requires a larger effect
- --detect-fdr <detect_fdr>
FDR (Benjamini-Hochberg) for calling a region a domain by bridge-pair enrichment; higher calls more (weaker) domains
- --merge-fdr <merge_fdr>
FDR (Benjamini-Hochberg) for merging adjacent domains by bridge-pair enrichment; higher merges more, lower merges fewer
- --widen, --no-widen
Grow each domain into its flanking gaps up to max-domain-length (runs before –fill); closes small gaps entirely
- --fill, --no-fill
Insert domains into every remaining gap (after –widen) so each position is in exactly one domain
- --max-domain-length <max_domain_length>
Bound every candidate domain to at most this many positions (0 = 2x median read length)
- --min-domain-length <min_domain_length>
Keep only domains with at least this many positions (skipped with –widen, which grows short domains instead)
- --min-pairs <min_pairs>
Keep only domains containing at least this many bridge pairs
- --min-clusters <min_clusters>
Start at this many clusters
- -k, --max-clusters <max_clusters>
Stop at this many clusters (0 for no limit)
- -e, --min-em-runs <min_em_runs>
Run EM (successfully) at least this number of times for each K
- -E, --max-em-runs <max_em_runs>
Run EM (successfully or not) at most this number of times for each K
- --em-thresh <em_thresh>
Stop EM when the log likelihood increases by less than this threshold
- --min-em-iter <min_em_iter>
Run EM for at least this many iterations
- --max-em-iter <max_em_iter>
Run EM for at most this many iterations
- --max-pearson-run <max_pearson_run>
Remove runs with two clusters more similar than this correlation
- --min-marcd-run <min_marcd_run>
Remove runs with two clusters that differ by less than this MARCD
- --max-arcd-vs-ens-avg <max_arcd_vs_ens_avg>
Remove runs where a cluster differs by more than this ARCD from the ensemble average at any position
- --max-gini-run <max_gini_run>
Remove runs where any cluster’s Gini coefficient exceeds this limit
- --jackpot, --no-jackpot
Calculate the jackpotting quotient to find over-represented reads
- --jackpot-conf-level <jackpot_conf_level>
Confidence level for the jackpotting quotient confidence interval
- --max-jackpot-quotient <max_jackpot_quotient>
Remove runs whose jackpotting quotient exceeds this limit
- --max-jackpot-sims <max_jackpot_sims>
Maximum number of simulations to compute the jackpotting quotient
- --jackpot-max-data <jackpot_max_data>
Skip calculating the jackpotting quotient if the reads × positions exceeds this limit
- --max-loglike-vs-best <max_loglike_vs_best>
Remove Ks with a log likelihood gap larger than this (0 for no limit)
- --min-pearson-vs-best <min_pearson_vs_best>
Remove Ks where every run has less than this correlation vs. the best
- --max-marcd-vs-best <max_marcd_vs_best>
Remove Ks where every run has more than this MARCD vs. the best
- --try-all-ks, --stop-best-k
Try all numbers of clusters (Ks), even after finding the best number
- --write-all-ks, --write-best-k
Write all numbers of clusters (Ks), rather than only the best number
- --cluster-pos-table, --no-cluster-pos-table
Tabulate relationships per position for cluster data
- --cluster-abundance-table, --no-cluster-abundance-table
Tabulate number of reads per cluster for cluster data
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --validate-gaps, --no-validate-gaps
In clusterscan, test each gap between domains for independence and merge failing gaps; off by default (expensive)
- --gap-min-assoc <gap_min_assoc>
Minimum deviation of fitted joint cluster proportions from independence to keep a gap unmerged; higher merges fewer gaps
- --cluster, --no-cluster
Cluster reads to find alternative structures
- --fold, --no-fold
Predict the secondary structure using the reactivities
- -F, --fold-regions-file <fold_regions_file>
Fold regions of references from coordinates/primers in a CSV file
- --fold-coords <fold_coords>
Fold a region of a reference given its 5’ and 3’ end coordinates
- --fold-primers <fold_primers>
Fold a region of a reference given its forward and reverse primers
- --fold-table-region, --fold-full-region
If no regions are specified, whether to default to the table’s region or to the full region
- --fold-dry-run, --fold-real-run
Only generate the fold command and input files; do not run folding
- --fold-backend <fold_backend>
Model RNA structures using RNAstructure (Fold/ShapeKnots) or ViennaRNA (RNAfold/RNAsubopt); auto selects RNAstructure for DMS and ViennaRNA for other probes
- Options:
auto | RNAstructure | ViennaRNA
- --pseudoknots, --no-pseudoknots
Predict pseudoknotted structures (requires –fold-backend=RNAstructure; uses ShapeKnots when set, Fold otherwise)
- --fold-energy-method <fold_energy_method>
Use this method to incorporate reactivities into folding energies. auto selects Cordero for DMS and Eddy for other probes; Eddy requires –fold-backend=ViennaRNA; Cordero requires –fold-backend=RNAstructure
- Options:
auto | Deigan | Cordero | Eddy
- --fold-temp <fold_temp>
Predict structures at this temperature (Celsius)
- --deigan-slope <deigan_slope>
Slope (kcal/mol) for SHAPE reactivities using Deigan method; used only with –fold-energy-method=Deigan
- --deigan-intercept <deigan_intercept>
Intercept (kcal/mol) for SHAPE reactivities using Deigan method; used only with –fold-energy-method=Deigan
- --fold-quantile <fold_quantile>
Normalize and winsorize reactivities to this quantile for folding
- --fold-fpaired <fold_fpaired>
Assume this fraction of bases is paired when computing Cordero pseudoenergies for cofolding
- --fold-constraint <fold_constraint>
Force bases to be paired/unpaired from a file of constraints
- --fold-commands <fold_commands>
Command file for RNAFold
- --eddy-prior-paired-file <eddy_prior_paired_file>
File of per-position prior probabilities of being paired for the Eddy method (passed as –sp-data with –sp-strategy Pp); only used with –fold-energy-method=Eddy and –fold-backend=ViennaRNA
- --eddy-prior-unpaired-file <eddy_prior_unpaired_file>
File of per-position prior probabilities of being unpaired for the Eddy method (passed as –sp-data with –sp-strategy Pu); only used with –fold-energy-method=Eddy and –fold-backend=ViennaRNA
- --fold-md <fold_md>
Limit base pair distances to this number of bases (0 for no limit)
- --fold-mfe, --fold-sub
Predict only the minimum free energy (MFE) structure
- --fold-max <fold_max>
Output at most this many structures (overriden by –fold-mfe)
- --fold-percent <fold_percent>
Stop outputting structures when the % difference in energy exceeds this value (overriden by –fold-mfe)
- --fold-edelta <fold_edelta>
Maximum energy difference (kcal/mol) from the MFE for suboptimal structures from RNAsubopt (overriden by –fold-mfe)
- --fold-isolated, --fold-stacked
Allow isolated (non-stacked) base pairs when folding
- --draw, --no-draw
Draw secondary structures with RNArtist.
- --struct-num <struct_num>
Draw the specified structure (zero-indexed) or -1 for all; by default, draws the structure with the best AUROC.
- --color, --no-color
Color bases by their reactivity
- --draw-svg, --no-draw-svg
Output each drawing in a Scalable Vector Graphics file
- --draw-png, --no-draw-png
Output each drawing in a Portable Network Graphics file
- --update-rnartistcore, --no-update-rnartistcore
Check for and install updates to RNArtistCore.
- --export, --no-export
Export each sample to SEISMICgraph (https://seismicrna.org)
- -S, --samples-meta <samples_meta>
Add sample metadata from this CSV file to exported results
- --all-pos, --unmasked-pos
Export all positions (not just unmasked positions)
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- --hist-bins <hist_bins>
Number of bins in each histogram; must be ≥ 1
- --hist-margin <hist_margin>
Autofill margins of at most this width in histograms of ratios
- --struct-file <struct_file>
Compare mutational profiles to the structure(s) in this CT file
- --terminal-pairs, --no-terminal-pairs
Include terminal base pairs (at the ends of stems) in ROC curves
- --window <window>
Use a sliding window of this many bases
- -n, --winmin <winmin>
Mask sliding windows with fewer than this number of data
- --graph-quantile <graph_quantile>
Normalize and winsorize ratios to this quantile (0 disables)
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --graph-mprof, --no-graph-mprof
Graph mutational profiles
- --graph-tmprof, --no-graph-tmprof
Graph typed mutational profiles
- --graph-ncov, --no-graph-ncov
Graph coverages per position
- --graph-mhist, --no-graph-mhist
Graph histograms of mutations per read
- --graph-abundance, --no-graph-abundance
Graph abundance of each cluster
- --graph-giniroll, --no-graph-giniroll
Graph rolling Gini coefficients
- --graph-roc, --no-graph-roc
Graph receiver operating characteristic (ROC) curves
- --graph-aucroll, --no-graph-aucroll
Graph rolling areas under ROC curves (AUC-ROC)
- --graph-poscorr, --no-graph-poscorr
Graph phi correlations between positions
- --graph-mutdist, --no-graph-mutdist
Graph distances between mutations
- --mutdist-null, --no-mutdist-null
Include the null distribution of distances between mutations
- --collate, --no-collate
Collate HTML graphs and SVG drawings into an HTML report file.
- --name <name>
Prefix the HTML report with this name.
- --verbose-name, --no-verbose-name
Add collated file information to report name.
- --collate-out-dir <collate_out_dir>
Write collated report to this directory. By default, write to the lowest level directory common to all input graphs.
- --include-svg, --no-include-svg
Include RNA structure drawings from the draw module.
- --include-graph, --no-include-graph
Include graphs from the graph module.
- --group <group>
Group collated graphs by one of ‘sample’, ‘graph’, ‘branches’, ‘region’, or ‘all’.
- --portable, --no-portable
Embed collated graphs into the output HTML file for portability at the expense of live updates and file size.
Arguments
- FASTA
Required argument
- INPUT_PATH
Optional argument(s)
Run individual steps of the workflow
seismic demult
Demultiplex sequencing reads by their barcode.
Usage
seismic demult [OPTIONS] FASTA
Options
- -x, --fastqx <fastqx>
FASTQ files of paired-end reads with mates 1 and 2 in separate files
- -y, --fastqy <fastqy>
FASTQ file(s) of paired-end reads with mates 1 and 2 interleaved
- -z, --fastqz <fastqz>
FASTQ file(s) of single-end reads
- -X, --dmfastqx <dmfastqx>
Demultiplexed FASTQ files of mate 1 and mate 2 reads
- -Y, --dmfastqy <dmfastqy>
Demultiplexed FASTQ files of paired-end reads interleaved in one file
- -Z, --dmfastqz <dmfastqz>
Demultiplexed FASTQ files of single-end reads
- --phred-enc <phred_enc>
Specify the Phred score encoding of FASTQ and SAM/BAM/CRAM files
- -R, --refs-meta <refs_meta>
Add reference metadata from this CSV file to exported results
- --barcode-start <barcode_start>
Index of start of barcode
- --barcode-end <barcode_end>
Index of end of barcode
- --read-pos <read_pos>
Expected position of the barcode in the read (1-indexed). Defaults to –barcode-start
- --barcode <barcode>
A list of barcode name, barcode sequence, and barcode position (1-indexed relative to read start) to demultiplex
- --mismatch-tolerance <mismatch_tolerance>
Match patterns with up to this many mismatches (grows factorially; caution above 2; not applied to clipped sequences)
- --index-tolerance <index_tolerance>
Allow patterns to be found in reads up to this distance from the reference index.
- --allow-n, --no-allow-n
Allow N as a valid mismatch when –mismatch-tolerance ≥ 1. Increases memory consumption.
- -o, --out-dir <out_dir>
Write all output files to this directory
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- -b, --branch <branch>
Create a new branch of the workflow with this name
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
Arguments
- FASTA
Required argument
seismic align
Trim FASTQ files and align them to reference sequences.
Usage
seismic align [OPTIONS] FASTA
Options
- -x, --fastqx <fastqx>
FASTQ files of paired-end reads with mates 1 and 2 in separate files
- -y, --fastqy <fastqy>
FASTQ file(s) of paired-end reads with mates 1 and 2 interleaved
- -z, --fastqz <fastqz>
FASTQ file(s) of single-end reads
- -X, --dmfastqx <dmfastqx>
Demultiplexed FASTQ files of mate 1 and mate 2 reads
- -Y, --dmfastqy <dmfastqy>
Demultiplexed FASTQ files of paired-end reads interleaved in one file
- -Z, --dmfastqz <dmfastqz>
Demultiplexed FASTQ files of single-end reads
- --phred-enc <phred_enc>
Specify the Phred score encoding of FASTQ and SAM/BAM/CRAM files
- -o, --out-dir <out_dir>
Write all output files to this directory
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- -b, --branch <branch>
Create a new branch of the workflow with this name
- --fastp, --no-fastp
Use fastp to QC, filter, and trim reads before alignment
- --fastp-5, --no-fastp-5
Trim low-quality bases from the 5’ ends of reads
- --fastp-3, --no-fastp-3
Trim low-quality bases from the 3’ ends of reads
- --fastp-w <fastp_w>
Use this window size (nt) for –fastp-5 and –fastp-3
- --fastp-m <fastp_m>
Use this mean quality threshold for –fastp-5 and –fastp-3
- --fastp-poly-g <fastp_poly_g>
Trim poly(G) tails (two-color sequencing artifacts) from the 3’ end
- Options:
yes | no | auto
- --fastp-poly-g-min-len <fastp_poly_g_min_len>
Minimum number of Gs to consider a poly(G) tail for –fastp-poly-g
- --fastp-poly-x, --no-fastp-poly-x
Trim poly(X) tails (i.e. of any nucleotide) from the 3’ end
- --fastp-poly-x-min-len <fastp_poly_x_min_len>
Minimum number of bases to consider a poly(X) tail for –fastp-poly-x
- --fastp-adapter-trimming, --no-fastp-adapter-trimming
Trim adapter sequences from the 3’ ends of reads
- --fastp-adapter-1 <fastp_adapter_1>
Trim this adapter sequence from the 3’ ends of read 1s
- --fastp-adapter-2 <fastp_adapter_2>
Trim this adapter sequence from the 3’ ends of read 2s
- --fastp-adapter-fasta <fastp_adapter_fasta>
Trim adapter sequences in this FASTA file from the 3’ ends of reads
- --fastp-detect-adapter-for-pe, --no-fastp-detect-adapter-for-pe
Automatically detect the adapter sequences for paired-end reads
- --fastp-min-length <fastp_min_length>
Discard reads shorter than this length
- --bt2-local, --bt2-end-to-end
Align reads in local mode rather than end-to-end mode
- --bt2-discordant, --bt2-no-discordant
Output paired-end reads whose mates align discordantly
- --bt2-mixed, --bt2-no-mixed
Attempt to align individual mates of pairs that fail to align
- --bt2-dovetail, --bt2-no-dovetail
Consider dovetailed mate pairs to align concordantly
- --bt2-contain, --bt2-no-contain
Consider nested mate pairs to align concordantly
- --bt2-I <bt2_i>
Discard paired-end alignments shorter than this many bases
- --bt2-X <bt2_x>
Discard paired-end alignments longer than this many bases
- --bt2-score-min-e2e <bt2_score_min_e2e>
Discard alignments that score below this threshold in end-to-end mode
- --bt2-score-min-loc <bt2_score_min_loc>
Discard alignments that score below this threshold in local mode
- --bt2-i <bt2_s>
Seed Bowtie2 alignments at this interval
- --bt2-L <bt2_l>
Use this seed length for Bowtie2
- --bt2-gbar <bt2_gbar>
Do not place gaps within this many bases from the end of a read
- --bt2-D <bt2_d>
Discard alignments if over this many consecutive seed extensions fail
- --bt2-R <bt2_r>
Re-seed reads with repetitive seeds up to this many times
- --bt2-dpad <bt2_dpad>
Pad the alignment matrix with this many bases (to allow gaps)
- --bt2-orient <bt2_orient>
Require paired mates to have this orientation
- Options:
fr | rf | ff
- --bt2-un, --bt2-no-un
Output unaligned reads to a FASTQ file
- --seed <seed>
Seed for the random number generator
- --min-mapq <min_mapq>
Discard reads with mapping qualities below this threshold
- -N, --min-reads <min_reads>
Discard alignment maps with fewer than this many reads
- --sep-strands, --mix-strands
Separate each alignment map into forward- and reverse-strand reads
- --f1r2-fwd, --f1r2-rev
With –sep-strands, consider forward mate 1s and reverse mate 2s to be forward-stranded
- --rev-label <rev_label>
With –sep-strands, add this label to each reverse-strand reference
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
Arguments
- FASTA
Required argument
seismic idmut
Identify mutations in aligned reads.
Usage
seismic idmut [OPTIONS] FASTA [INPUT_PATH]...
Options
- --sep-strands, --mix-strands
Separate each alignment map into forward- and reverse-strand reads
- --rev-label <rev_label>
With –sep-strands, add this label to each reverse-strand reference
- -o, --out-dir <out_dir>
Write all output files to this directory
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- -b, --branch <branch>
Create a new branch of the workflow with this name
- --min-mapq <min_mapq>
Discard reads with mapping qualities below this threshold
- --phred-enc <phred_enc>
Specify the Phred score encoding of FASTQ and SAM/BAM/CRAM files
- --min-phred <min_phred>
Mark base calls with Phred scores lower than this threshold as ambiguous
- -N, --min-reads <min_reads>
Discard alignment maps with fewer than this many reads
- --batch-size <batch_size>
Limit batches to at most this many reads
- --insert3, --insert5
Mark each insertion on the base to its 3’ (True) or 5’ (False) side
- --ambindel, --no-ambindel
Mark all ambiguous insertions and deletions (indels)
- --overhangs, --no-overhangs
Retain the overhangs of paired-end mates that dovetail
- -5, --clip-end5 <clip_end5>
Clip this many bases from the 5’ end of each read
- -3, --clip-end3 <clip_end3>
Clip this many bases from the 3’ end of each read
- --brotli-level <brotli_level>
Compress pickle files with this level of Brotli (0 - 11)
- --write-read-names, --no-write-read-names
Write the name of each read in a second set of batches (necessary for the options –drop-read or –drop-read-file)
- --idmut-pos-table, --no-idmut-pos-table
Tabulate relationships per position for idmut data
- --idmut-read-table, --no-idmut-read-table
Tabulate relationships per read for idmut data
- --idmut-cx, --idmut-py
Use the fast C-extension idmut algorithm; the slow Python version is a fallback if the C extension fails to load
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
Arguments
- FASTA
Required argument
- INPUT_PATH
Optional argument(s)
seismic pool
Merge samples (vertically) from the IDmut step.
Usage
seismic pool [OPTIONS] POOLED_SAMPLE [INPUT_PATH]...
Options
- --idmut-pos-table, --no-idmut-pos-table
Tabulate relationships per position for idmut data
- --idmut-read-table, --no-idmut-read-table
Tabulate relationships per read for idmut data
- --min-pearson <min_pearson>
Pool samples only if their Pearson correlation is at least this large
- --max-marcd <max_marcd>
Pool samples only if their mean arsince distance is at most this
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
Arguments
- POOLED_SAMPLE
Required argument
- INPUT_PATH
Optional argument(s)
seismic filter
Define mutations and regions to filter reads and positions.
Usage
seismic filter [OPTIONS] [INPUT_PATH]...
Options
- -b, --branch <branch>
Create a new branch of the workflow with this name
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- -c, --region-coords <region_coords>
Select a region of a reference given its 5’ and 3’ end coordinates
- -P, --region-primers <region_primers>
Select a region of a reference given its forward and reverse primers
- --primer-gap <primer_gap>
Leave a gap of this many bases between the primer and the region
- -i, --regions-file <regions_file>
Select regions of references from coordinates/primers in a CSV file
- --count-del, --no-del
Count deletions as mutations
- --count-ins, --no-ins
Count insertions as mutations
- --no-mut <no_mut>
Do not count this type of mutation (overrides –count-del/ins)
- --only-mut <only_mut>
Count only this type of mutation (overrides other mutation settings)
- --probe <probe>
Use the default options for this chemical probe
- Options:
DMS | SHAPE | ETC | none
- --mask-a, --keep-a
Mask positions with base A
- --mask-c, --keep-c
Mask positions with base C
- --mask-g, --keep-g
Mask positions with base G
- --mask-u, --keep-u
Mask positions with base U
- --mask-polya <mask_polya>
Mask stretches of at least this many consecutive A bases (0 disables); defaults to 5 for chemical probes, 0 for none
- --mask-pos <mask_pos>
Mask this position in this reference
- --mask-pos-file <mask_pos_file>
Mask positions in references from a file
- --min-ninfo-pos <min_ninfo_pos>
Mask positions with fewer than this many informative base calls
- --max-fmut-pos <max_fmut_pos>
Mask positions with more than this fraction of mutated base calls
- --drop-read <drop_read>
Drop the read with this name
- --drop-read-file <drop_read_file>
Drop the reads with names in this file
- --drop-discontig, --keep-discontig
Drop paired-end reads with discontiguous mates
- --min-ncov-read <min_ncov_read>
Drop reads with fewer than this many bases covering the region
- --min-fcov-read <min_fcov_read>
Drop reads covering less than this fraction of the region
- --min-finfo-read <min_finfo_read>
Drop reads with less than this fraction of informative base calls
- --max-fmut-read <max_fmut_read>
Drop reads with more than this fraction of mutated base calls
- --min-mut-gap <min_mut_gap>
Filter out mutations separated by fewer than this many bases
- --mut-collisions <mut_collisions>
If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.
- Options:
drop | merge | auto
- --quick-unbias, --exact-unbias
Correct observer bias using a quick (typically linear time) heuristic
- --quick-unbias-thresh <quick_unbias_thresh>
Treat mutated fractions under this threshold as 0 with –quick-unbias
- --max-filter-iter <max_filter_iter>
Stop the filter step after this many iterations (0 for no limit)
- --filter-pos-table, --no-filter-pos-table
Tabulate relationships per position for filter data
- --filter-read-table, --no-filter-read-table
Tabulate relationships per read for filter data
- --brotli-level <brotli_level>
Compress pickle files with this level of Brotli (0 - 11)
- --self-contained, --no-self-contained
Write self-contained batch files that skip loading predecessor batches (Filter/Cluster steps); costs more disk space
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
Arguments
- INPUT_PATH
Optional argument(s)
seismic cluster
Infer structure ensembles by clustering reads’ mutations.
Usage
seismic cluster [OPTIONS] [INPUT_PATH]...
Options
- -b, --branch <branch>
Create a new branch of the workflow with this name
- --min-clusters <min_clusters>
Start at this many clusters
- -k, --max-clusters <max_clusters>
Stop at this many clusters (0 for no limit)
- -e, --min-em-runs <min_em_runs>
Run EM (successfully) at least this number of times for each K
- -E, --max-em-runs <max_em_runs>
Run EM (successfully or not) at most this number of times for each K
- --em-thresh <em_thresh>
Stop EM when the log likelihood increases by less than this threshold
- --min-em-iter <min_em_iter>
Run EM for at least this many iterations
- --max-em-iter <max_em_iter>
Run EM for at most this many iterations
- --max-pearson-run <max_pearson_run>
Remove runs with two clusters more similar than this correlation
- --min-marcd-run <min_marcd_run>
Remove runs with two clusters that differ by less than this MARCD
- --max-arcd-vs-ens-avg <max_arcd_vs_ens_avg>
Remove runs where a cluster differs by more than this ARCD from the ensemble average at any position
- --max-gini-run <max_gini_run>
Remove runs where any cluster’s Gini coefficient exceeds this limit
- --jackpot, --no-jackpot
Calculate the jackpotting quotient to find over-represented reads
- --jackpot-conf-level <jackpot_conf_level>
Confidence level for the jackpotting quotient confidence interval
- --max-jackpot-quotient <max_jackpot_quotient>
Remove runs whose jackpotting quotient exceeds this limit
- --max-jackpot-sims <max_jackpot_sims>
Maximum number of simulations to compute the jackpotting quotient
- --jackpot-max-data <jackpot_max_data>
Skip calculating the jackpotting quotient if the reads × positions exceeds this limit
- --max-loglike-vs-best <max_loglike_vs_best>
Remove Ks with a log likelihood gap larger than this (0 for no limit)
- --min-pearson-vs-best <min_pearson_vs_best>
Remove Ks where every run has less than this correlation vs. the best
- --max-marcd-vs-best <max_marcd_vs_best>
Remove Ks where every run has more than this MARCD vs. the best
- --try-all-ks, --stop-best-k
Try all numbers of clusters (Ks), even after finding the best number
- --write-all-ks, --write-best-k
Write all numbers of clusters (Ks), rather than only the best number
- --cluster-pos-table, --no-cluster-pos-table
Tabulate relationships per position for cluster data
- --cluster-abundance-table, --no-cluster-abundance-table
Tabulate number of reads per cluster for cluster data
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --brotli-level <brotli_level>
Compress pickle files with this level of Brotli (0 - 11)
- --self-contained, --no-self-contained
Write self-contained batch files that skip loading predecessor batches (Filter/Cluster steps); costs more disk space
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- --seed <seed>
Seed for the random number generator
Arguments
- INPUT_PATH
Optional argument(s)
seismic join
Merge regions (horizontally) from the Filter or Cluster step.
Usage
seismic join [OPTIONS] JOINED_REGION [INPUT_PATH]...
Options
- -j, --join-clusts <join_clusts>
Specify which clusters to join clusters using this CSV file
- --filter-pos-table, --no-filter-pos-table
Tabulate relationships per position for filter data
- --filter-read-table, --no-filter-read-table
Tabulate relationships per read for filter data
- --cluster-pos-table, --no-cluster-pos-table
Tabulate relationships per position for cluster data
- --cluster-abundance-table, --no-cluster-abundance-table
Tabulate number of reads per cluster for cluster data
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
Arguments
- JOINED_REGION
Required argument
- INPUT_PATH
Optional argument(s)
seismic filterscan
Scan an RNA for domains of correlated base pairs.
Usage
seismic filterscan [OPTIONS] [INPUT_PATH]...
Options
- -b, --branch <branch>
Create a new branch of the workflow with this name
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- -c, --region-coords <region_coords>
Select a region of a reference given its 5’ and 3’ end coordinates
- -P, --region-primers <region_primers>
Select a region of a reference given its forward and reverse primers
- --primer-gap <primer_gap>
Leave a gap of this many bases between the primer and the region
- -i, --regions-file <regions_file>
Select regions of references from coordinates/primers in a CSV file
- --count-del, --no-del
Count deletions as mutations
- --count-ins, --no-ins
Count insertions as mutations
- --no-mut <no_mut>
Do not count this type of mutation (overrides –count-del/ins)
- --only-mut <only_mut>
Count only this type of mutation (overrides other mutation settings)
- --probe <probe>
Use the default options for this chemical probe
- Options:
DMS | SHAPE | ETC | none
- --mask-a, --keep-a
Mask positions with base A
- --mask-c, --keep-c
Mask positions with base C
- --mask-g, --keep-g
Mask positions with base G
- --mask-u, --keep-u
Mask positions with base U
- --mask-polya <mask_polya>
Mask stretches of at least this many consecutive A bases (0 disables); defaults to 5 for chemical probes, 0 for none
- --mask-pos <mask_pos>
Mask this position in this reference
- --mask-pos-file <mask_pos_file>
Mask positions in references from a file
- --min-ninfo-pos <min_ninfo_pos>
Mask positions with fewer than this many informative base calls
- --max-fmut-pos <max_fmut_pos>
Mask positions with more than this fraction of mutated base calls
- --drop-read <drop_read>
Drop the read with this name
- --drop-read-file <drop_read_file>
Drop the reads with names in this file
- --drop-discontig, --keep-discontig
Drop paired-end reads with discontiguous mates
- --min-ncov-read <min_ncov_read>
Drop reads with fewer than this many bases covering the region
- --min-fcov-read <min_fcov_read>
Drop reads covering less than this fraction of the region
- --min-finfo-read <min_finfo_read>
Drop reads with less than this fraction of informative base calls
- --max-fmut-read <max_fmut_read>
Drop reads with more than this fraction of mutated base calls
- --min-mut-gap <min_mut_gap>
Filter out mutations separated by fewer than this many bases
- --mut-collisions <mut_collisions>
If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.
- Options:
drop | merge | auto
- --quick-unbias, --exact-unbias
Correct observer bias using a quick (typically linear time) heuristic
- --quick-unbias-thresh <quick_unbias_thresh>
Treat mutated fractions under this threshold as 0 with –quick-unbias
- --max-filter-iter <max_filter_iter>
Stop the filter step after this many iterations (0 for no limit)
- --filter-pos-table, --no-filter-pos-table
Tabulate relationships per position for filter data
- --filter-read-table, --no-filter-read-table
Tabulate relationships per read for filter data
- --brotli-level <brotli_level>
Compress pickle files with this level of Brotli (0 - 11)
- --self-contained, --no-self-contained
Write self-contained batch files that skip loading predecessor batches (Filter/Cluster steps); costs more disk space
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- -L, --tile-length <tile_length>
Make each tile this length (if 0, use 2x the median read length)
- -O, --tile-min-overlap <tile_min_overlap>
Make adjacent tiles overlap by at least this fraction of length
- --erase-tiles, --keep-tiles
Erase the filter reports/batches from the tiling step
- --band-width <band_width>
Consider only position pairs no more than this far apart when finding domains (0 = bounded only by tile length)
- --min-pair-coverage <min_pair_coverage>
Analyze only position pairs with at least this many jointly covering reads (fewer reads are too noisy to score reliably)
- --min-expect-both <min_expect_both>
Analyze only position pairs whose expected both-mutated read count (under independence) is at least this value
- --pair-fdr <pair_fdr>
FDR (Benjamini-Hochberg) for calling a pair a domain-boundary bridge; higher calls more bridges
- --min-fold-change <min_fold_change>
Minimum expected-to-observed both-mutated fold change to call a pair a bridge; higher requires a larger effect
- --detect-fdr <detect_fdr>
FDR (Benjamini-Hochberg) for calling a region a domain by bridge-pair enrichment; higher calls more (weaker) domains
- --merge-fdr <merge_fdr>
FDR (Benjamini-Hochberg) for merging adjacent domains by bridge-pair enrichment; higher merges more, lower merges fewer
- --widen, --no-widen
Grow each domain into its flanking gaps up to max-domain-length (runs before –fill); closes small gaps entirely
- --fill, --no-fill
Insert domains into every remaining gap (after –widen) so each position is in exactly one domain
- --max-domain-length <max_domain_length>
Bound every candidate domain to at most this many positions (0 = 2x median read length)
- --min-domain-length <min_domain_length>
Keep only domains with at least this many positions (skipped with –widen, which grows short domains instead)
- --min-pairs <min_pairs>
Keep only domains containing at least this many bridge pairs
Arguments
- INPUT_PATH
Optional argument(s)
seismic clusterscan
Cluster the domains detected by filterscan.
Usage
seismic clusterscan [OPTIONS] [INPUT_PATH]...
Options
- -b, --branch <branch>
Create a new branch of the workflow with this name
- --min-clusters <min_clusters>
Start at this many clusters
- -k, --max-clusters <max_clusters>
Stop at this many clusters (0 for no limit)
- -e, --min-em-runs <min_em_runs>
Run EM (successfully) at least this number of times for each K
- -E, --max-em-runs <max_em_runs>
Run EM (successfully or not) at most this number of times for each K
- --em-thresh <em_thresh>
Stop EM when the log likelihood increases by less than this threshold
- --min-em-iter <min_em_iter>
Run EM for at least this many iterations
- --max-em-iter <max_em_iter>
Run EM for at most this many iterations
- --max-pearson-run <max_pearson_run>
Remove runs with two clusters more similar than this correlation
- --min-marcd-run <min_marcd_run>
Remove runs with two clusters that differ by less than this MARCD
- --max-arcd-vs-ens-avg <max_arcd_vs_ens_avg>
Remove runs where a cluster differs by more than this ARCD from the ensemble average at any position
- --max-gini-run <max_gini_run>
Remove runs where any cluster’s Gini coefficient exceeds this limit
- --jackpot, --no-jackpot
Calculate the jackpotting quotient to find over-represented reads
- --jackpot-conf-level <jackpot_conf_level>
Confidence level for the jackpotting quotient confidence interval
- --max-jackpot-quotient <max_jackpot_quotient>
Remove runs whose jackpotting quotient exceeds this limit
- --max-jackpot-sims <max_jackpot_sims>
Maximum number of simulations to compute the jackpotting quotient
- --jackpot-max-data <jackpot_max_data>
Skip calculating the jackpotting quotient if the reads × positions exceeds this limit
- --max-loglike-vs-best <max_loglike_vs_best>
Remove Ks with a log likelihood gap larger than this (0 for no limit)
- --min-pearson-vs-best <min_pearson_vs_best>
Remove Ks where every run has less than this correlation vs. the best
- --max-marcd-vs-best <max_marcd_vs_best>
Remove Ks where every run has more than this MARCD vs. the best
- --try-all-ks, --stop-best-k
Try all numbers of clusters (Ks), even after finding the best number
- --write-all-ks, --write-best-k
Write all numbers of clusters (Ks), rather than only the best number
- --cluster-pos-table, --no-cluster-pos-table
Tabulate relationships per position for cluster data
- --cluster-abundance-table, --no-cluster-abundance-table
Tabulate number of reads per cluster for cluster data
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --brotli-level <brotli_level>
Compress pickle files with this level of Brotli (0 - 11)
- --self-contained, --no-self-contained
Write self-contained batch files that skip loading predecessor batches (Filter/Cluster steps); costs more disk space
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- --seed <seed>
Seed for the random number generator
- --validate-gaps, --no-validate-gaps
In clusterscan, test each gap between domains for independence and merge failing gaps; off by default (expensive)
- --gap-min-assoc <gap_min_assoc>
Minimum deviation of fitted joint cluster proportions from independence to keep a gap unmerged; higher merges fewer gaps
Arguments
- INPUT_PATH
Optional argument(s)
seismic table
Tabulate counts of relationships per read and position.
Usage
seismic table [OPTIONS] [INPUT_PATH]...
Options
- --idmut-pos-table, --no-idmut-pos-table
Tabulate relationships per position for idmut data
- --idmut-read-table, --no-idmut-read-table
Tabulate relationships per read for idmut data
- --filter-pos-table, --no-filter-pos-table
Tabulate relationships per position for filter data
- --filter-read-table, --no-filter-read-table
Tabulate relationships per read for filter data
- --cluster-pos-table, --no-cluster-pos-table
Tabulate relationships per position for cluster data
- --cluster-abundance-table, --no-cluster-abundance-table
Tabulate number of reads per cluster for cluster data
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
Arguments
- INPUT_PATH
Optional argument(s)
seismic duplex
Combine two references into a duplex for cofolding.
Usage
seismic duplex [OPTIONS] [INPUT_PATH]...
Options
- --duplex-pair, --no-duplex-pair
Duplex every pair of input profiles
- --dimer, --no-dimer
Duplex each input profile with itself, to model a homodimer
- --duplex-file <duplex_file>
Duplex each input profile with the sequences in this FASTA file (the second strand of each duplex, without any mutational data)
- --duplex-sequence <duplex_sequence>
Duplex each input profile with a named strand given as its name and its raw sequence 5’ to 3’ (e.g. –duplex-sequence ASO ATTCACTTTCATAATGCTGG); this second strand carries no mutational data
- --duplex-table-region, --duplex-full
Default for every strand: build it from only the source table’s region (–duplex-table-region), or from its full reference sequence with the table’s data mapped onto that region (–duplex-full, the default)
- --duplex-full-ref <duplex_full_ref>
Build the strand for this reference from its full reference sequence, overriding –duplex-full/–duplex-table-region for it (repeatable)
- --duplex-region-ref <duplex_region_ref>
Build the strand for this reference from only its table region, overriding –duplex-full/–duplex-table-region for it (repeatable)
- -b, --branch <branch>
Create a new branch of the workflow with this name
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
Arguments
- INPUT_PATH
Optional argument(s)
seismic fold
Predict RNA secondary structures using mutation rates.
Usage
seismic fold [OPTIONS] [INPUT_PATH]...
Options
- -b, --branch <branch>
Create a new branch of the workflow with this name
- -F, --fold-regions-file <fold_regions_file>
Fold regions of references from coordinates/primers in a CSV file
- --fold-coords <fold_coords>
Fold a region of a reference given its 5’ and 3’ end coordinates
- --fold-primers <fold_primers>
Fold a region of a reference given its forward and reverse primers
- --fold-table-region, --fold-full-region
If no regions are specified, whether to default to the table’s region or to the full region
- --fold-dry-run, --fold-real-run
Only generate the fold command and input files; do not run folding
- --fold-backend <fold_backend>
Model RNA structures using RNAstructure (Fold/ShapeKnots) or ViennaRNA (RNAfold/RNAsubopt); auto selects RNAstructure for DMS and ViennaRNA for other probes
- Options:
auto | RNAstructure | ViennaRNA
- --pseudoknots, --no-pseudoknots
Predict pseudoknotted structures (requires –fold-backend=RNAstructure; uses ShapeKnots when set, Fold otherwise)
- --fold-energy-method <fold_energy_method>
Use this method to incorporate reactivities into folding energies. auto selects Cordero for DMS and Eddy for other probes; Eddy requires –fold-backend=ViennaRNA; Cordero requires –fold-backend=RNAstructure
- Options:
auto | Deigan | Cordero | Eddy
- --fold-temp <fold_temp>
Predict structures at this temperature (Celsius)
- --deigan-slope <deigan_slope>
Slope (kcal/mol) for SHAPE reactivities using Deigan method; used only with –fold-energy-method=Deigan
- --deigan-intercept <deigan_intercept>
Intercept (kcal/mol) for SHAPE reactivities using Deigan method; used only with –fold-energy-method=Deigan
- --fold-quantile <fold_quantile>
Normalize and winsorize reactivities to this quantile for folding
- --fold-fpaired <fold_fpaired>
Assume this fraction of bases is paired when computing Cordero pseudoenergies for cofolding
- --fold-constraint <fold_constraint>
Force bases to be paired/unpaired from a file of constraints
- --fold-commands <fold_commands>
Command file for RNAFold
- --eddy-prior-paired-file <eddy_prior_paired_file>
File of per-position prior probabilities of being paired for the Eddy method (passed as –sp-data with –sp-strategy Pp); only used with –fold-energy-method=Eddy and –fold-backend=ViennaRNA
- --eddy-prior-unpaired-file <eddy_prior_unpaired_file>
File of per-position prior probabilities of being unpaired for the Eddy method (passed as –sp-data with –sp-strategy Pu); only used with –fold-energy-method=Eddy and –fold-backend=ViennaRNA
- --fold-md <fold_md>
Limit base pair distances to this number of bases (0 for no limit)
- --fold-mfe, --fold-sub
Predict only the minimum free energy (MFE) structure
- --fold-max <fold_max>
Output at most this many structures (overriden by –fold-mfe)
- --fold-percent <fold_percent>
Stop outputting structures when the % difference in energy exceeds this value (overriden by –fold-mfe)
- --fold-edelta <fold_edelta>
Maximum energy difference (kcal/mol) from the MFE for suboptimal structures from RNAsubopt (overriden by –fold-mfe)
- --fold-isolated, --fold-stacked
Allow isolated (non-stacked) base pairs when folding
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph
seismic graph profile
Bar graph of relationships(s) per position.
Usage
seismic graph profile [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --use-ratio, --use-count
Graph ratios or counts
- -r, --rels <rels>
Graph these relationship(s)
- --graph-quantile <graph_quantile>
Normalize and winsorize ratios to this quantile (0 disables)
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph delprof
Bar graph of differences between two profiles per position.
Usage
seismic graph delprof [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --use-ratio, --use-count
Graph ratios or counts
- -r, --rels <rels>
Graph these relationship(s)
- --graph-quantile <graph_quantile>
Normalize and winsorize ratios to this quantile (0 disables)
- --comppair, --no-comppair
Compare every pair of table files
- --compself, --no-compself
Compare every table file with itself
- -o, --out-dir <out_dir>
Write all output files to this directory
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph scatter
Scatter plot comparing two profiles.
Usage
seismic graph scatter [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --use-ratio, --use-count
Graph ratios or counts
- -r, --rels <rels>
Graph these relationship(s)
- --graph-quantile <graph_quantile>
Normalize and winsorize ratios to this quantile (0 disables)
- --comppair, --no-comppair
Compare every pair of table files
- --compself, --no-compself
Compare every table file with itself
- -o, --out-dir <out_dir>
Write all output files to this directory
- -m, --metric <metric>
Metric to compare mutation rates: ‘pcc’ = Pearson correlation coefficient (r), ‘scc’ = Spearman correlation coefficient (ρ), ‘r2’ = coefficient of determination (R²), ‘marcd’ = mean arcsine distance (MARCD)
- Options:
marcd | pcc | scc | r2
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph corroll
Rolling correlation/comparison of two profiles.
Usage
seismic graph corroll [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --use-ratio, --use-count
Graph ratios or counts
- -r, --rels <rels>
Graph these relationship(s)
- --graph-quantile <graph_quantile>
Normalize and winsorize ratios to this quantile (0 disables)
- --window <window>
Use a sliding window of this many bases
- -n, --winmin <winmin>
Mask sliding windows with fewer than this number of data
- --comppair, --no-comppair
Compare every pair of table files
- --compself, --no-compself
Compare every table file with itself
- -o, --out-dir <out_dir>
Write all output files to this directory
- -m, --metric <metric>
Metric to compare mutation rates: ‘pcc’ = Pearson correlation coefficient (r), ‘scc’ = Spearman correlation coefficient (ρ), ‘r2’ = coefficient of determination (R²), ‘marcd’ = mean arcsine distance (MARCD)
- Options:
marcd | pcc | scc | r2
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph giniroll
Rolling Gini coefficient.
Usage
seismic graph giniroll [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --use-ratio, --use-count
Graph ratios or counts
- -r, --rels <rels>
Graph these relationship(s)
- --graph-quantile <graph_quantile>
Normalize and winsorize ratios to this quantile (0 disables)
- --window <window>
Use a sliding window of this many bases
- -n, --winmin <winmin>
Mask sliding windows with fewer than this number of data
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph snrroll
Rolling signal-to-noise ratio.
Usage
seismic graph snrroll [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --use-ratio, --use-count
Graph ratios or counts
- -r, --rels <rels>
Graph these relationship(s)
- --graph-quantile <graph_quantile>
Normalize and winsorize ratios to this quantile (0 disables)
- --window <window>
Use a sliding window of this many bases
- -n, --winmin <winmin>
Mask sliding windows with fewer than this number of data
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph histpos
Histogram of relationship(s) per position.
Usage
seismic graph histpos [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --use-ratio, --use-count
Graph ratios or counts
- -r, --rels <rels>
Graph these relationship(s)
- --graph-quantile <graph_quantile>
Normalize and winsorize ratios to this quantile (0 disables)
- --hist-bins <hist_bins>
Number of bins in each histogram; must be ≥ 1
- --hist-margin <hist_margin>
Autofill margins of at most this width in histograms of ratios
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph histread
Histogram of relationship(s) per read.
Usage
seismic graph histread [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --use-ratio, --use-count
Graph ratios or counts
- -r, --rels <rels>
Graph these relationship(s)
- --graph-quantile <graph_quantile>
Normalize and winsorize ratios to this quantile (0 disables)
- --hist-bins <hist_bins>
Number of bins in each histogram; must be ≥ 1
- --hist-margin <hist_margin>
Autofill margins of at most this width in histograms of ratios
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph mutdist
Distance between the closest two mutations in each read.
Usage
seismic graph mutdist [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- -r, --rels <rels>
Graph these relationship(s)
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --mutdist-null, --no-mutdist-null
Include the null distribution of distances between mutations
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph poscorr
Phi correlations between pairs of positions.
Usage
seismic graph poscorr [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- -r, --rels <rels>
Graph these relationship(s)
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph roc
ROC curve comparing a profile to a structure.
Usage
seismic graph roc [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --use-ratio, --use-count
Graph ratios or counts
- -r, --rels <rels>
Graph these relationship(s)
- --graph-quantile <graph_quantile>
Normalize and winsorize ratios to this quantile (0 disables)
- --struct-file <struct_file>
Compare mutational profiles to the structure(s) in this CT file
- -b, --branch <branch>
Create a new branch of the workflow with this name
- -F, --fold-regions-file <fold_regions_file>
Fold regions of references from coordinates/primers in a CSV file
- --fold-coords <fold_coords>
Fold a region of a reference given its 5’ and 3’ end coordinates
- --fold-primers <fold_primers>
Fold a region of a reference given its forward and reverse primers
- --fold-table-region, --fold-full-region
If no regions are specified, whether to default to the table’s region or to the full region
- --terminal-pairs, --no-terminal-pairs
Include terminal base pairs (at the ends of stems) in ROC curves
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph aucroll
Rolling AUC-ROC comparing a profile to a structure.
Usage
seismic graph aucroll [OPTIONS] [INPUT_PATH]...
Options
- --cgroup <cgroup>
Put each Cluster in its own file, each K in its own file, or All clusters in one file
- Options:
c | k | a
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --use-ratio, --use-count
Graph ratios or counts
- -r, --rels <rels>
Graph these relationship(s)
- --graph-quantile <graph_quantile>
Normalize and winsorize ratios to this quantile (0 disables)
- --struct-file <struct_file>
Compare mutational profiles to the structure(s) in this CT file
- -b, --branch <branch>
Create a new branch of the workflow with this name
- -F, --fold-regions-file <fold_regions_file>
Fold regions of references from coordinates/primers in a CSV file
- --fold-coords <fold_coords>
Fold a region of a reference given its 5’ and 3’ end coordinates
- --fold-primers <fold_primers>
Fold a region of a reference given its forward and reverse primers
- --fold-table-region, --fold-full-region
If no regions are specified, whether to default to the table’s region or to the full region
- --terminal-pairs, --no-terminal-pairs
Include terminal base pairs (at the ends of stems) in ROC curves
- --window <window>
Use a sliding window of this many bases
- -n, --winmin <winmin>
Mask sliding windows with fewer than this number of data
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic graph abundance
Abundance of each cluster.
Usage
seismic graph abundance [OPTIONS] [INPUT_PATH]...
Options
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --use-ratio, --use-count
Graph ratios or counts
- --csv, --no-csv
Output the data for each graph in a Comma-Separated Values file
- --html, --no-html
Output each graph in an interactive HyperText Markup Language file
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic draw
Draw RNA structures with reactivities using RNArtistCore.
Usage
seismic draw [OPTIONS] [INPUT_PATH]...
Options
- --fold-table-region, --fold-full-region
If no regions are specified, whether to default to the table’s region or to the full region
- --struct-num <struct_num>
Draw the specified structure (zero-indexed) or -1 for all; by default, draws the structure with the best AUROC.
- --color, --no-color
Color bases by their reactivity
- --draw-svg, --no-draw-svg
Output each drawing in a Scalable Vector Graphics file
- --draw-png, --no-draw-png
Output each drawing in a Portable Network Graphics file
- --update-rnartistcore, --no-update-rnartistcore
Check for and install updates to RNArtistCore.
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic collate
Collate HTML graphs and SVG drawings into an HTML report file.
Usage
seismic collate [OPTIONS] [INPUT_PATH]...
Options
- --name <name>
Prefix the HTML report with this name.
- --verbose-name, --no-verbose-name
Add collated file information to report name.
- --collate-out-dir <collate_out_dir>
Write collated report to this directory. By default, write to the lowest level directory common to all input graphs.
- --include-svg, --no-include-svg
Include RNA structure drawings from the draw module.
- --include-graph, --no-include-graph
Include graphs from the graph module.
- --group <group>
Group collated graphs by one of ‘sample’, ‘graph’, ‘branches’, ‘region’, or ‘all’.
- --portable, --no-portable
Embed collated graphs into the output HTML file for portability at the expense of live updates and file size.
- --force, --no-force
Force all tasks to run, overwriting any existing output files
Arguments
- INPUT_PATH
Optional argument(s)
seismic export
Export each sample to SEISMICgraph (https://seismicrna.org).
Usage
seismic export [OPTIONS] [INPUT_PATH]...
Options
- -S, --samples-meta <samples_meta>
Add sample metadata from this CSV file to exported results
- -R, --refs-meta <refs_meta>
Add reference metadata from this CSV file to exported results
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --all-pos, --unmasked-pos
Export all positions (not just unmasked positions)
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
Utility commands
seismic splitbam
Split a BAM file into one file for each reference.
Usage
seismic splitbam [OPTIONS] FASTA [INPUT_PATH]...
Options
- --phred-enc <phred_enc>
Specify the Phred score encoding of FASTQ and SAM/BAM/CRAM files
- -o, --out-dir <out_dir>
Write all output files to this directory
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- -b, --branch <branch>
Create a new branch of the workflow with this name
- --bt2-local, --bt2-end-to-end
Align reads in local mode rather than end-to-end mode
- --bt2-discordant, --bt2-no-discordant
Output paired-end reads whose mates align discordantly
- --bt2-mixed, --bt2-no-mixed
Attempt to align individual mates of pairs that fail to align
- --bt2-dovetail, --bt2-no-dovetail
Consider dovetailed mate pairs to align concordantly
- --bt2-contain, --bt2-no-contain
Consider nested mate pairs to align concordantly
- --bt2-I <bt2_i>
Discard paired-end alignments shorter than this many bases
- --bt2-X <bt2_x>
Discard paired-end alignments longer than this many bases
- --bt2-score-min-loc <bt2_score_min_loc>
Discard alignments that score below this threshold in local mode
- --bt2-score-min-e2e <bt2_score_min_e2e>
Discard alignments that score below this threshold in end-to-end mode
- --bt2-i <bt2_s>
Seed Bowtie2 alignments at this interval
- --bt2-L <bt2_l>
Use this seed length for Bowtie2
- --bt2-D <bt2_d>
Discard alignments if over this many consecutive seed extensions fail
- --bt2-R <bt2_r>
Re-seed reads with repetitive seeds up to this many times
- --bt2-gbar <bt2_gbar>
Do not place gaps within this many bases from the end of a read
- --bt2-dpad <bt2_dpad>
Pad the alignment matrix with this many bases (to allow gaps)
- --bt2-orient <bt2_orient>
Require paired mates to have this orientation
- Options:
fr | rf | ff
- --seed <seed>
Seed for the random number generator
- --min-mapq <min_mapq>
Discard reads with mapping qualities below this threshold
- -N, --min-reads <min_reads>
Discard alignment maps with fewer than this many reads
- --sep-strands, --mix-strands
Separate each alignment map into forward- and reverse-strand reads
- --f1r2-fwd, --f1r2-rev
With –sep-strands, consider forward mate 1s and reverse mate 2s to be forward-stranded
- --rev-label <rev_label>
With –sep-strands, add this label to each reverse-strand reference
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
Arguments
- FASTA
Required argument
- INPUT_PATH
Optional argument(s)
seismic cleanfa
Clean the names and sequences in FASTA files.
Usage
seismic cleanfa [OPTIONS] [INPUT_PATH]...
Options
- --inplace, --no-inplace
Modify files in-place instead of writing new files (CAUTION: you cannot recover the original files afterwards)
- -o, --out-dir <out_dir>
Write all output files to this directory
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic list
List positions to mask.
Usage
seismic list [OPTIONS] [INPUT_PATH]...
Options
- -b, --branch <branch>
Create a new branch of the workflow with this name
- --min-ninfo-pos <min_ninfo_pos>
Mask positions with fewer than this many informative base calls
- --max-fmut-pos <max_fmut_pos>
Mask positions with more than this fraction of mutated base calls
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic renumct
Renumber connectivity table (CT) files given a 5’ position.
Usage
seismic renumct [OPTIONS]
Options
- --ct-pos-5 <ct_pos_5>
Connectivity table (CT) file or directory of CT files and the 5’ position to assign to each file
- --inplace, --no-inplace
Modify files in-place instead of writing new files (CAUTION: you cannot recover the original files afterwards)
- -o, --out-dir <out_dir>
Write all output files to this directory
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
seismic ct2db
Convert connectivity table (CT) to dot-bracket (DB) files.
Usage
seismic ct2db [OPTIONS] [INPUT_PATH]...
Options
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic db2ct
Convert dot-bracket (DB) to connectivity table (CT) files.
Usage
seismic db2ct [OPTIONS] [INPUT_PATH]...
Options
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic importmm
Import RNA Framework Mutation Map (MM) files as IDmut outputs.
Usage
seismic importmm [OPTIONS] [INPUT_PATH]...
Options
- -o, --out-dir <out_dir>
Write all output files to this directory
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- -b, --branch <branch>
Create a new branch of the workflow with this name
- -s, --sample <sample>
Required Give this name to the imported sample
- -N, --min-reads <min_reads>
Discard alignment maps with fewer than this many reads
- --batch-size <batch_size>
Limit batches to at most this many reads
- --insert3, --insert5
Mark each insertion on the base to its 3’ (True) or 5’ (False) side
- --brotli-level <brotli_level>
Compress pickle files with this level of Brotli (0 - 11)
- --write-read-names, --no-write-read-names
Write the name of each read in a second set of batches (necessary for the options –drop-read or –drop-read-file)
- --idmut-pos-table, --no-idmut-pos-table
Tabulate relationships per position for idmut data
- --idmut-read-table, --no-idmut-read-table
Tabulate relationships per read for idmut data
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
Arguments
- INPUT_PATH
Optional argument(s)
seismic migrate
Migrate output directories from v0.24 to v0.25
Usage
seismic migrate [OPTIONS] [INPUT_PATH]...
Options
- -o, --out-dir <out_dir>
Write all output files to this directory
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)
seismic fold datapath
Guess the DATAPATH for RNAstructure.
Usage
seismic fold datapath [OPTIONS]
seismic test
Run all unit tests.
Usage
seismic test [OPTIONS]
Options
- -v, --verbose
Log more messages (-v for debug, -vv for trace) on stderr
seismic sim
seismic sim total
Simulate FASTQ files from scratch.
Usage
seismic sim total [OPTIONS]
Options
- --max-tries <max_tries>
Simulate the parameters with up to this many attempts
- --mask-a, --keep-a
Mask positions with base A
- --mask-c, --keep-c
Mask positions with base C
- --mask-g, --keep-g
Mask positions with base G
- --mask-u, --keep-u
Mask positions with base U
- --mask-polya <mask_polya>
Mask stretches of at least this many consecutive A bases (0 disables); defaults to 5 for chemical probes, 0 for none
- --max-fraction-ident <max_fraction_ident>
Retry if any two clusters have more than this fraction of identical mutation rates
- --max-pearson-sim <max_pearson_sim>
Retry if any two clusters have a Pearson correlation larger than this
- --min-marcd-sim <min_marcd_sim>
Retry if any two clusters have a MARCD less than this (0 disables)
- --profile-name <profile_name>
Give the simulated structure and parameters this profile name
- -s, --sample <sample>
Give this name to the simulated sample
- --paired-end, --single-end
Simulate paired-end or single-end reads
- --read-length <read_length>
Simulate reads with this many base calls
- --reverse-fraction <reverse_fraction>
Simulate this fraction of reverse-oriented reads
- --probe <probe>
Use the default options for this chemical probe
- Options:
DMS | SHAPE | ETC | none
- --min-mut-gap-weights <min_mut_gap_weights>
Comma-separated gap:weight pairs for a mixture of min_mut_gap biases, e.g. ‘0:0.2,1:0.3,2:0.5’ (empty string disables)
- --mut-collisions <mut_collisions>
If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.
- Options:
drop | merge | auto
- --injected-mut-probs <injected_mut_probs>
Comma-separated offset:prob pairs (offset ≥ 1): odds of a mutation offset positions 5’ of one, e.g. ‘1:0.1,2:0.01’
- --fq-gzip, --fq-text
Simulate FASTQ files with gzip compression or as plain text
- --num-reads <num_reads>
Simulate this many reads
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --seed <seed>
Seed for the random number generator
- --sim-dir <sim_dir>
Write all simulated files to this directory
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --fold-backend <fold_backend>
Model RNA structures using RNAstructure (Fold/ShapeKnots) or ViennaRNA (RNAfold/RNAsubopt); auto selects RNAstructure for DMS and ViennaRNA for other probes
- Options:
auto | RNAstructure | ViennaRNA
- --pseudoknots, --no-pseudoknots
Predict pseudoknotted structures (requires –fold-backend=RNAstructure; uses ShapeKnots when set, Fold otherwise)
- -F, --fold-regions-file <fold_regions_file>
Fold regions of references from coordinates/primers in a CSV file
- --fold-coords <fold_coords>
Fold a region of a reference given its 5’ and 3’ end coordinates
- --fold-primers <fold_primers>
Fold a region of a reference given its forward and reverse primers
- --fold-constraint <fold_constraint>
Force bases to be paired/unpaired from a file of constraints
- --fold-temp <fold_temp>
Predict structures at this temperature (Celsius)
- --fold-md <fold_md>
Limit base pair distances to this number of bases (0 for no limit)
- --fold-mfe, --fold-sub
Predict only the minimum free energy (MFE) structure
- --fold-max <fold_max>
Output at most this many structures (overriden by –fold-mfe)
- --fold-min <fold_min>
Require at least this many structures (overriden by –fold-mfe)
- --fold-percent <fold_percent>
Stop outputting structures when the % difference in energy exceeds this value (overriden by –fold-mfe)
- --fold-edelta <fold_edelta>
Maximum energy difference (kcal/mol) from the MFE for suboptimal structures from RNAsubopt (overriden by –fold-mfe)
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- --clust-conc <clust_conc>
Set the concentration parameter for simulating cluster proportions
- --center-fmean <center_fmean>
Set the mean read center as a fraction of the region length
- --center-fvar <center_fvar>
Set the variance of the read center as a fraction of its maximum
- --length-fmean <length_fmean>
Set the mean read length as a fraction of the region length
- --length-fvar <length_fvar>
Set the variance of the read length as a fraction of its maximum
- -p, --pmut-paired <pmut_paired>
Set the mean rate of each kind of mutation for paired bases
- -u, --pmut-unpaired <pmut_unpaired>
Set the mean rate of each kind of mutation for unpaired bases
- -v, --vmut-paired <vmut_paired>
Set the relative variance of mutation rates of each kind of paired base
- -w, --vmut-unpaired <vmut_unpaired>
Set the relative variance of mutation rates of each kind of unpaired base
- -c, --region-coords <region_coords>
Select a region of a reference given its 5’ and 3’ end coordinates
- -P, --region-primers <region_primers>
Select a region of a reference given its forward and reverse primers
- --refs <refs>
Give this name to the file of simulated references
- --ref <ref>
Give this name to the simulated reference
- --reflen <reflen>
Simulate a reference sequence with this many bases
seismic sim ref
Simulate a FASTA file of a reference sequence.
Usage
seismic sim ref [OPTIONS]
Options
- --sim-dir <sim_dir>
Write all simulated files to this directory
- --refs <refs>
Give this name to the file of simulated references
- --ref <ref>
Give this name to the simulated reference
- --reflen <reflen>
Simulate a reference sequence with this many bases
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --seed <seed>
Seed for the random number generator
seismic sim fold
Simulate secondary structure(s) a reference sequence.
Usage
seismic sim fold [OPTIONS] FASTA
Options
- --sim-dir <sim_dir>
Write all simulated files to this directory
- -t, --tmp-pfx <tmp_pfx>
Write all temporary files to a directory with this prefix
- --profile-name <profile_name>
Give the simulated structure and parameters this profile name
- --probe <probe>
Use the default options for this chemical probe
- Options:
DMS | SHAPE | ETC | none
- --fold-backend <fold_backend>
Model RNA structures using RNAstructure (Fold/ShapeKnots) or ViennaRNA (RNAfold/RNAsubopt); auto selects RNAstructure for DMS and ViennaRNA for other probes
- Options:
auto | RNAstructure | ViennaRNA
- --pseudoknots, --no-pseudoknots
Predict pseudoknotted structures (requires –fold-backend=RNAstructure; uses ShapeKnots when set, Fold otherwise)
- -F, --fold-regions-file <fold_regions_file>
Fold regions of references from coordinates/primers in a CSV file
- --fold-coords <fold_coords>
Fold a region of a reference given its 5’ and 3’ end coordinates
- --fold-primers <fold_primers>
Fold a region of a reference given its forward and reverse primers
- --fold-constraint <fold_constraint>
Force bases to be paired/unpaired from a file of constraints
- --fold-temp <fold_temp>
Predict structures at this temperature (Celsius)
- --fold-md <fold_md>
Limit base pair distances to this number of bases (0 for no limit)
- --fold-mfe, --fold-sub
Predict only the minimum free energy (MFE) structure
- --fold-max <fold_max>
Output at most this many structures (overriden by –fold-mfe)
- --fold-min <fold_min>
Require at least this many structures (overriden by –fold-mfe)
- --fold-percent <fold_percent>
Stop outputting structures when the % difference in energy exceeds this value (overriden by –fold-mfe)
- --fold-edelta <fold_edelta>
Maximum energy difference (kcal/mol) from the MFE for suboptimal structures from RNAsubopt (overriden by –fold-mfe)
- --keep-tmp, --erase-tmp
Keep temporary files after finishing
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- FASTA
Required argument
seismic sim params
Simulate parameter files.
Usage
seismic sim params [OPTIONS]
Options
- --ct-file <ct_file>
Simulate parameters using the structure(s) in this CT file
- --clust-conc <clust_conc>
Set the concentration parameter for simulating cluster proportions
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --seed <seed>
Seed for the random number generator
- --center-fmean <center_fmean>
Set the mean read center as a fraction of the region length
- --center-fvar <center_fvar>
Set the variance of the read center as a fraction of its maximum
- --length-fmean <length_fmean>
Set the mean read length as a fraction of the region length
- --length-fvar <length_fvar>
Set the variance of the read length as a fraction of its maximum
- -p, --pmut-paired <pmut_paired>
Set the mean rate of each kind of mutation for paired bases
- -u, --pmut-unpaired <pmut_unpaired>
Set the mean rate of each kind of mutation for unpaired bases
- -v, --vmut-paired <vmut_paired>
Set the relative variance of mutation rates of each kind of paired base
- -w, --vmut-unpaired <vmut_unpaired>
Set the relative variance of mutation rates of each kind of unpaired base
- --probe <probe>
Use the default options for this chemical probe
- Options:
DMS | SHAPE | ETC | none
- -c, --region-coords <region_coords>
Select a region of a reference given its 5’ and 3’ end coordinates
- -P, --region-primers <region_primers>
Select a region of a reference given its forward and reverse primers
seismic sim muts
Simulate the rate of each kind of mutation at each position.
Usage
seismic sim muts [OPTIONS]
Options
- --ct-file <ct_file>
Simulate parameters using the structure(s) in this CT file
- -p, --pmut-paired <pmut_paired>
Set the mean rate of each kind of mutation for paired bases
- -u, --pmut-unpaired <pmut_unpaired>
Set the mean rate of each kind of mutation for unpaired bases
- -v, --vmut-paired <vmut_paired>
Set the relative variance of mutation rates of each kind of paired base
- -w, --vmut-unpaired <vmut_unpaired>
Set the relative variance of mutation rates of each kind of unpaired base
- --probe <probe>
Use the default options for this chemical probe
- Options:
DMS | SHAPE | ETC | none
- -c, --region-coords <region_coords>
Select a region of a reference given its 5’ and 3’ end coordinates
- -P, --region-primers <region_primers>
Select a region of a reference given its forward and reverse primers
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --seed <seed>
Seed for the random number generator
seismic sim ends
Simulate the proportions of 5’ and 3’ end coordinates.
Usage
seismic sim ends [OPTIONS]
Options
- --ct-file <ct_file>
Simulate parameters using the structure(s) in this CT file
- --center-fmean <center_fmean>
Set the mean read center as a fraction of the region length
- --center-fvar <center_fvar>
Set the variance of the read center as a fraction of its maximum
- --length-fmean <length_fmean>
Set the mean read length as a fraction of the region length
- --length-fvar <length_fvar>
Set the variance of the read length as a fraction of its maximum
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
seismic sim clusts
Simulate the proportions of 5’ and 3’ end coordinates.
Usage
seismic sim clusts [OPTIONS]
Options
- --ct-file <ct_file>
Simulate parameters using the structure(s) in this CT file
- --clust-conc <clust_conc>
Set the concentration parameter for simulating cluster proportions
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --seed <seed>
Seed for the random number generator
seismic sim idmut
Simulate an IDmut dataset.
Usage
seismic sim idmut [OPTIONS]
Options
- -d, --param-dir <param_dir>
Simulate data using parameter files in this directory
- --profile-name <profile_name>
Give the simulated structure and parameters this profile name
- -s, --sample <sample>
Give this name to the simulated sample
- -b, --branch <branch>
Create a new branch of the workflow with this name
- --paired-end, --single-end
Simulate paired-end or single-end reads
- --read-length <read_length>
Simulate reads with this many base calls
- --reverse-fraction <reverse_fraction>
Simulate this fraction of reverse-oriented reads
- --probe <probe>
Use the default options for this chemical probe
- Options:
DMS | SHAPE | ETC | none
- --min-mut-gap-weights <min_mut_gap_weights>
Comma-separated gap:weight pairs for a mixture of min_mut_gap biases, e.g. ‘0:0.2,1:0.3,2:0.5’ (empty string disables)
- --mut-collisions <mut_collisions>
If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.
- Options:
drop | merge | auto
- --injected-mut-probs <injected_mut_probs>
Comma-separated offset:prob pairs (offset ≥ 1): odds of a mutation offset positions 5’ of one, e.g. ‘1:0.1,2:0.01’
- --num-reads <num_reads>
Simulate this many reads
- --batch-size <batch_size>
Limit batches to at most this many reads
- --write-read-names, --no-write-read-names
Write the name of each read in a second set of batches (necessary for the options –drop-read or –drop-read-file)
- --brotli-level <brotli_level>
Compress pickle files with this level of Brotli (0 - 11)
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --seed <seed>
Seed for the random number generator
seismic sim fastq
Simulate a FASTQ file.
Usage
seismic sim fastq [OPTIONS] [INPUT_PATH]...
Options
- -d, --param-dir <param_dir>
Simulate data using parameter files in this directory
- --profile-name <profile_name>
Give the simulated structure and parameters this profile name
- -s, --sample <sample>
Give this name to the simulated sample
- --paired-end, --single-end
Simulate paired-end or single-end reads
- --read-length <read_length>
Simulate reads with this many base calls
- --reverse-fraction <reverse_fraction>
Simulate this fraction of reverse-oriented reads
- --probe <probe>
Use the default options for this chemical probe
- Options:
DMS | SHAPE | ETC | none
- --min-mut-gap-weights <min_mut_gap_weights>
Comma-separated gap:weight pairs for a mixture of min_mut_gap biases, e.g. ‘0:0.2,1:0.3,2:0.5’ (empty string disables)
- --mut-collisions <mut_collisions>
If two mutations are closer than –min-mut-gap positions, MERGE them, DROP the read, or AUTO-select based on the probe.
- Options:
drop | merge | auto
- --injected-mut-probs <injected_mut_probs>
Comma-separated offset:prob pairs (offset ≥ 1): odds of a mutation offset positions 5’ of one, e.g. ‘1:0.1,2:0.01’
- --fq-gzip, --fq-text
Simulate FASTQ files with gzip compression or as plain text
- --num-reads <num_reads>
Simulate this many reads
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
- --force, --no-force
Force all tasks to run, overwriting any existing output files
- --seed <seed>
Seed for the random number generator
Arguments
- INPUT_PATH
Optional argument(s)
seismic sim abstract
Abstract simulation parameters from tables and structures.
Usage
seismic sim abstract [OPTIONS] [INPUT_PATH]...
Options
- --fold-table-region, --fold-full-region
If no regions are specified, whether to default to the table’s region or to the full region
- -F, --fold-regions-file <fold_regions_file>
Fold regions of references from coordinates/primers in a CSV file
- --fold-coords <fold_coords>
Fold a region of a reference given its 5’ and 3’ end coordinates
- --fold-primers <fold_primers>
Fold a region of a reference given its forward and reverse primers
- --struct-file <struct_file>
Compare mutational profiles to the structure(s) in this CT file
- -b, --branch <branch>
Create a new branch of the workflow with this name
- --min-aucroc <min_aucroc>
Skip tables/profiles where the AUC-ROC is less than this value
- --verify-times, --no-verify-times
Verify that report files from later steps have later timestamps
- --num-cpus <num_cpus>
Use up to this many CPUs simultaneously
Arguments
- INPUT_PATH
Optional argument(s)